National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10913R-3 
 Symbol Spn6  Full Name Serine protease inhibitor 6 
 CG No CG10913  Old CG No CG10913 
 Synonyms CG10913, sp6, sp-6, Spn6 
 Accession No (Link to NCBI) NM_080214.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nakaoka T, Iga M, Yamada T, Koujima I, Takeshima M, Zhou X, Suzuki Y, Ogihara MH, Kataoka H.
Deep sequencing of the prothoracic gland transcriptome reveals new players in insect ecdysteroidogenesis.
PLoS ONE (2017) 12(3) e0172951 [ PubMed ID = 28257485 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAATTTGGAATTTGCGCGTGG 
 Primer Seq. 3'
aatctagaggtaccCCTTGAAGTGGAGGGCATTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAATTTGGAA TTTGCGCGTG GAGGTGCCCG TTTCACCAGC GAACTTTTTC AGCTTTTGAG 
0061 CGCTGGCGGG CTCAAGGAGA ACGTCGTCTT CTCGCCCTTC TCCATCCAAA CTTGCATTGC 
0121 CCTGGCCTTT GCCGGATCGC AGGGTGAAAC CGCCGACGAG ATCGCCAAGG CACTGCACTT 
0181 CGTCTCCAAC TTTCCGCCGG AGGTGGCCCA AACGTTCCAG TTTGTACTGG AGAAGTACCG 
0241 CAACAGTAAC CTGCTGCGCG TTGCCAACAA GCTGTACGTG CAAGAGGGCA AGCANGCTGA 
0301 AGCCCGCCTA CCAGTCGGCT ATCAAGGAGC AGTATCATTC GGAGGCGGAG TCCATTAACT 
0361 TTGCGCTCAA CGATGCCGCC GCCCAGGCCA TCAATGCCTG GGTGAATGCC AAGACTCAGG 
0421 GCAAGATTAC GGAGCTGGTC AGCGCAGGAC TCGTTCTCGG ACAACACCAG GCTGGTCCTG 
0481 CTCAATGCCC TCCACTTCAA GG 
 in silico PCR Fragment
0001 CAATTTGGAA TTTGCGCGTG GAGGTGCCCG TTTCACCAGC GAACTTTTTC AGCTTTTGAG 
0061 CGCTGGCGGG CTCAAGGAGA ACGTCGTCTT CTCGCCCTTC TCCATCCAAA CTTGCATTGC 
0121 CCTGGCCTTT GCCGGATCGC AGGGTGAAAC CGCCGACGAG ATCGCCAAGG CACTGCACTT 
0181 CGTCTCCAAC TTTCCGCCGG AGGTGGCCCA AACGTTCCAG TTTGTGCTGG AGAAGTACCG 
0241 CAACAGTAAC CTGCTGCGCG TTGCCAACAA GCTGTACGTG CAGGAGGGCA AGCA-GCTGA 
0301 AGCCCGCCTA CCAGTCGGCC ATCAAGGAGC AGTATCATTC GGAGGCGGAG TCCATTAACT 
0361 TTGCGCTCAA CGATGCCGCC GCCCAGGCCA TCAATGCCTG GGTGAATGCC AAGACTCAGG 
0421 GCAAGATTAC GGAGCTGGTC AGCGC-GGAC TCGTTCTCGG ACAACACCAG GCTGGTCCTG 
0481 CTCAATGCCC TCCACTTCAA GG 
 Assemble Data

10913R-3.IR_full       1   CAATTTGGAATTTGCGCGTGGAGGTGCCCGTTTCACCAGCGAACTTTTTCAGCTTTTGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10913R-3.in silico     1   CAATTTGGAATTTGCGCGTGGAGGTGCCCGTTTCACCAGCGAACTTTTTCAGCTTTTGAG 60


10913R-3.IR_full       61  CGCTGGCGGGCTCAAGGAGAACGTCGTCTTCTCGCCCTTCTCCATCCAAACTTGCATTGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10913R-3.in silico     61  CGCTGGCGGGCTCAAGGAGAACGTCGTCTTCTCGCCCTTCTCCATCCAAACTTGCATTGC 120


10913R-3.IR_full       121 CCTGGCCTTTGCCGGATCGCAGGGTGAAACCGCCGACGAGATCGCCAAGGCACTGCACTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10913R-3.in silico     121 CCTGGCCTTTGCCGGATCGCAGGGTGAAACCGCCGACGAGATCGCCAAGGCACTGCACTT 180


10913R-3.IR_full       181 CGTCTCCAACTTTCCGCCGGAGGTGGCCCAAACGTTCCAGTTTGTACTGGAGAAGTACCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
10913R-3.in silico     181 CGTCTCCAACTTTCCGCCGGAGGTGGCCCAAACGTTCCAGTTTGTGCTGGAGAAGTACCG 240


10913R-3.IR_full       241 CAACAGTAACCTGCTGCGCGTTGCCAACAAGCTGTACGTGCAAGAGGGCAAGCANGCTGA 300
                           |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||
10913R-3.in silico     241 CAACAGTAACCTGCTGCGCGTTGCCAACAAGCTGTACGTGCAGGAGGGCAAGCA-GCTGA 300


10913R-3.IR_full       301 AGCCCGCCTACCAGTCGGCTATCAAGGAGCAGTATCATTCGGAGGCGGAGTCCATTAACT 360
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
10913R-3.in silico     301 AGCCCGCCTACCAGTCGGCCATCAAGGAGCAGTATCATTCGGAGGCGGAGTCCATTAACT 360


10913R-3.IR_full       361 TTGCGCTCAACGATGCCGCCGCCCAGGCCATCAATGCCTGGGTGAATGCCAAGACTCAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10913R-3.in silico     361 TTGCGCTCAACGATGCCGCCGCCCAGGCCATCAATGCCTGGGTGAATGCCAAGACTCAGG 420


10913R-3.IR_full       421 GCAAGATTACGGAGCTGGTCAGCGCAGGACTCGTTCTCGGACAACACCAGGCTGGTCCTG 480
                           ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
10913R-3.in silico     421 GCAAGATTACGGAGCTGGTCAGCGC-GGACTCGTTCTCGGACAACACCAGGCTGGTCCTG 480


10913R-3.IR_full       481 CTCAATGCCCTCCACTTCAAGG 502
                           ||||||||||||||||||||||
10913R-3.in silico     481 CTCAATGCCCTCCACTTCAAGG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080214.2  CG10913-RA (Spn6), mRNA 
0   12  NM_080216.2  CG9453-RB, transcript variant B (Spn4), mRNA 
0   12  NM_206032.1  CG9453-RK, transcript variant K (Spn4), mRNA 
0   12  NM_206035.1  CG9453-RH, transcript variant H (Spn4), mRNA 
0   12  NM_165496.2  CG9453-RA, transcript variant A (Spn4), mRNA 
0   12  NM_165495.2  CG9453-RC, transcript variant C (Spn4), mRNA 
0   12  NM_206033.1  CG9453-RJ, transcript variant J (Spn4), mRNA 
0   12  NM_206036.1  CG9453-RG, transcript variant G (Spn4), mRNA 
0   12  NM_206034.1  CG9453-RI, transcript variant I (Spn4), mRNA 
0   12  NM_206037.1  CG9453-RF, transcript variant F (Spn4), mRNA 
0   12  NM_206039.1  CG9453-RD, transcript variant D (Spn4), mRNA 
0   12  NM_206038.1  CG9453-RE, transcript variant E (Spn4), mRNA 
0   NM_058045.4  CG9148-RB, transcript variant B (scf), mRNA 
0   NM_206231.1  CG9148-RC, transcript variant C (scf), mRNA 
0   NM_058044.4  CG9148-RA, transcript variant A (scf), mRNA 
0   NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0   NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0   12  NM_080112.1  CG1857-RA (nec), mRNA 
0   NM_176501.1  CG18525-RB, transcript variant B (Spn5), mRNA 
0   NM_080215.2  CG18525-RA, transcript variant A (Spn5), mRNA 
0   NM_141985.1  CG7381-RA, transcript variant A (CG7381), mRNA 
0   NM_169485.1  CG7381-RB, transcript variant B (CG7381), mRNA 
0   NM_169486.1  CG7381-RC, transcript variant C (CG7381), mRNA 
0   NM_137077.2  CG13350-RA (CG13350), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   NM_079738.2  CG6768-RA (DNApol-epsilon), mRNA 
0   NM_079088.2  CG9952-RA (ppa), mRNA 
0   11  NM_080219.3  CG9456-RA (Spn1), mRNA 
0   NM_169629.1  CG6476-RB, transcript variant B (Su(var)3-9), mRNA 
0   NM_169630.1  CG6476-RC, transcript variant C (Su(var)3-9), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.