National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10901R-2 
 Symbol osk  Full Name oskar 
 CG No CG10901  Old CG No CG10901 
 Synonyms CG10901, osk, Oskar, Osk, OSK 
 Accession No (Link to NCBI) NM_169248.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATTCCCCAGCAAACCGATCAG 
 Primer Seq. 3'
aatctagaggtaccTCACTCTTGATGCTCGATATC 
 Predicted Fragment Size
519 
 IR fragment full Seq
0001 aTTCCCCAGC AAACCGATCA GTTATACCAG CACCAATACT TCCGCCAAAA CCTATTATCT 
0061 TAAGTCCGTG AAAAAGCGGG TGACCACGTG TTTCCAGCAG TTGCGCNGAT AAACTCCAGT 
0121 CATCCGGTTC CTTTCGCAAG AGTTCCTCCA GCTGCCTCAA CCAGATCTTC GTAAGGTCCG 
0181 ATTTCTCCGC ATGCGGCGAA CGCTTTCGGA AGATCTTCAA ATCGGCGCGA AAAACCGAAT 
0241 TGCCGGAGTT GTGGAAGGTG CCATTGGTGG CCCATGAACT CACCAGCCGG CAGAGCAGCC 
0301 AGCAGTTGCA AGTCGTAGCC AGACTCTTCT CGTCCACTCA GATTTCCACC AAGGAAATCA 
0361 CCTACAACAG CAACAGCAAC ACCAGCGAGA ACAACATGAC CATCATCGAG AGCAACTATA 
0421 TATCCGTGCG CGAGGAATAT CCCGATATAG ATAGTGAGGT GCGCGCCATA TTGCTGAgCC 
0481 ACGCCCAGAA TGGAATCACG ATATCGAGCA TCAAGAGTGA  
 in silico PCR Fragment
0001 ATTCCCCAGC AAACCGATCA GTTATACCAG CACCAATACT TCCGCCAAAA CCTATTATCT 
0061 TAAGTCCGTG AAAAAGCGGG TGACCACGTG TTTCCAGCAG TTGCGC-GAT AAACTCCAGT 
0121 CATCCGGTTC CTTTCGCAAG AGTTCCTCCA GCTGCCTCAA CCAGATCTTC GTAAGGTCCG 
0181 ATTTCTCCGC ATGCGGCGAA CGCTTTCGGA AGATCTTCAA ATCGGCGCGA AAAACCGAAT 
0241 TGCCGGAGTT GTGGAAGGTG CCATTGGTGG CCCATGAACT CACCAGCCGG CAGAGCAGCC 
0301 AGCAGTTGCA AGTCGTAGCC AGACTCTTCT CGTCCACTCA GATTTCCACC AAGGAAATCA 
0361 CCTACAACAG CAACAGCAAC ACCAGCGAGA ACAACATGAC CATCATCGAG AGCAACTATA 
0421 TATCCGTGCG CGAGGAATAT CCCGATATAG ATAGTGAGGT GCGCGCCATA TTGCTGAGCC 
0481 ACGCCCAGAA TGGAATCACG ATATCGAGCA TCAAGAGTGA  
 Assemble Data

10901R-2.IR_full       1   ATTCCCCAGCAAACCGATCAGTTATACCAGCACCAATACTTCCGCCAAAACCTATTATCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     1   ATTCCCCAGCAAACCGATCAGTTATACCAGCACCAATACTTCCGCCAAAACCTATTATCT 60


10901R-2.IR_full       61  TAAGTCCGTGAAAAAGCGGGTGACCACGTGTTTCCAGCAGTTGCGCNGATAAACTCCAGT 120
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
10901R-2.in silico     61  TAAGTCCGTGAAAAAGCGGGTGACCACGTGTTTCCAGCAGTTGCGC-GATAAACTCCAGT 120


10901R-2.IR_full       121 CATCCGGTTCCTTTCGCAAGAGTTCCTCCAGCTGCCTCAACCAGATCTTCGTAAGGTCCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     121 CATCCGGTTCCTTTCGCAAGAGTTCCTCCAGCTGCCTCAACCAGATCTTCGTAAGGTCCG 180


10901R-2.IR_full       181 ATTTCTCCGCATGCGGCGAACGCTTTCGGAAGATCTTCAAATCGGCGCGAAAAACCGAAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     181 ATTTCTCCGCATGCGGCGAACGCTTTCGGAAGATCTTCAAATCGGCGCGAAAAACCGAAT 240


10901R-2.IR_full       241 TGCCGGAGTTGTGGAAGGTGCCATTGGTGGCCCATGAACTCACCAGCCGGCAGAGCAGCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     241 TGCCGGAGTTGTGGAAGGTGCCATTGGTGGCCCATGAACTCACCAGCCGGCAGAGCAGCC 300


10901R-2.IR_full       301 AGCAGTTGCAAGTCGTAGCCAGACTCTTCTCGTCCACTCAGATTTCCACCAAGGAAATCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     301 AGCAGTTGCAAGTCGTAGCCAGACTCTTCTCGTCCACTCAGATTTCCACCAAGGAAATCA 360


10901R-2.IR_full       361 CCTACAACAGCAACAGCAACACCAGCGAGAACAACATGACCATCATCGAGAGCAACTATA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     361 CCTACAACAGCAACAGCAACACCAGCGAGAACAACATGACCATCATCGAGAGCAACTATA 420


10901R-2.IR_full       421 TATCCGTGCGCGAGGAATATCCCGATATAGATAGTGAGGTGCGCGCCATATTGCTGAGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     421 TATCCGTGCGCGAGGAATATCCCGATATAGATAGTGAGGTGCGCGCCATATTGCTGAGCC 480


10901R-2.IR_full       481 ACGCCCAGAATGGAATCACGATATCGAGCATCAAGAGTGA 520
                           ||||||||||||||||||||||||||||||||||||||||
10901R-2.in silico     481 ACGCCCAGAATGGAATCACGATATCGAGCATCAAGAGTGA 520

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   501  NM_169248.2  CG10901-RA, transcript variant A (osk), mRNA 
100   501  NM_206464.1  CG10901-RC, transcript variant C (osk), mRNA 
0.79   14  82  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
0.59   48  NM_165853.1  CG13188-RA, transcript variant A (CG13188), mRNA 
0.59   29  NM_136870.1  CG13188-RB, transcript variant B (CG13188), mRNA 
0.39   28  82  NM_057376.2  CG7734-RC, transcript variant C (shn), mRNA 
0.39   28  82  NM_134279.2  CG7734-RB, transcript variant B (shn), mRNA 
0.39   28  82  NM_057375.3  CG7734-RA, transcript variant A (shn), mRNA 
0.39   28  82  NM_206091.1  CG7734-RD, transcript variant D (shn), mRNA 
0.39   35  73  NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0.39   29  63  NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0.39   29  63  NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0.19   10  40  NM_057895.3  CG14938-RA, transcript variant A (crol), mRNA 
0.19   10  40  NM_057897.3  CG14938-RB, transcript variant B (crol), mRNA 
0.19   10  40  NM_164971.1  CG14938-RD, transcript variant D (crol), mRNA 
0.19   10  40  NM_057896.3  CG14938-RC, transcript variant C (crol), mRNA 
0.19   35  99  NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0.19   35  99  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0.19   19  55  NM_206303.1  CG6964-RD, transcript variant D (Gug), mRNA 
0.19   17  44  NM_176300.1  CG6964-RC, transcript variant C (Gug), mRNA 
0.19   17  44  NM_079249.2  CG6964-RB, transcript variant B (Gug), mRNA 
0.19   17  44  NM_145106.1  CG6964-RA, transcript variant A (Gug), mRNA 
0.19   NM_140708.2  CG6485-RA (CG6485), mRNA 
0.19   NM_135894.2  CG15270-RA, transcript variant A (CG15270), mRNA 
0.19   NM_205997.1  CG15270-RB, transcript variant B (CG15270), mRNA 
0   21  67  155  NM_132288.1  CG15365-RA (CG15365), mRNA 
0   13  35  98  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0   13  35  98  NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0   12  66  133  NM_139493.2  CG2083-RA (CG2083), mRNA 
0   12  38  51  NM_136647.2  CG8809-RA (Camta), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.