National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10897R-4 
 Symbol tou  Full Name toutatis 
 CG No CG10897  Old CG No CG10897 
 Synonyms Dm Tou, CG10897, gene VI, VI, EP(2)0622, EP622, anon-48Ad, EP0622, tou, transcript group VI, toutatis 
 Accession No (Link to NCBI) NM_078977.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACGACCCCACCGGCCTTTTA 
 Primer Seq. 3'
aatctagaggtaccAACCCGATGAGGATCCACCAC 
 Predicted Fragment Size
520 
 IR fragment full Seq
0001 CACGACCCCA CCGGCCTTTT AGATGCAGCT TCCCTGTTCG CTTACTGGGG ACGTGATCCA 
0061 ACTGGAGCGG CGGCTGCAGC GGCTTCCAAT CCGCTCTTCA ACTCGCAGTT CAATGCCGCC 
0121 GCTGCTGCCG GATTGGGTTT ATTGCCACAA GCTGGAGGCG CCTCTGCCAA TGACCGTTAT 
0181 TCCATGGCAG CAGCAGCGGC GGCTGCGGCG GGAGCCCATC ACCACCAGAA CACGATGGCA 
0241 GTGGCCGCTT TCCCAGGCCG CCAGTTTGGC CGGTTTGCAT CCAGCAAGCT GGTGGTCAAT 
0301 GGCCCAGTTA GCTGCCCAGG ATTACTTCAG TCGCCTGCAA GCCTCGGGTC TTTCCCCCTT 
0361 TCCACAATCC CGATCTGGCG GCTGCCTTTG GACCAGCTGG GATGGGAATG GGCGGCGGTG 
0421 CTGGTGGAGC GGGTGCTGGA GGTGGTGGAG CAGGTGTACT CGGCCAGGGC GGCGGTGGAA 
0481 ATGGCGGAAG TGGCAACGGT GGTGGTGGAT CCTCATCGGG TT 
 in silico PCR Fragment
0001 CACGACCCCA CCGGCCTTTT AGATGCAGCT TCCCTGTTCG CTTACTGGGG ACGTGATCCA 
0061 ACTGGAGCGG CGGCTGCAGC GGCTTCCAAT CCGCTCTTCA ACTCGCAGTT CAATGCCGCC 
0121 GCTGCTGCCG GATTGGGTTT ATTGCCACAA GCTGGAGGCG CCTCTGCCAA TGACCGTTAT 
0181 TCCATGGCAG CAGCAGCGGC GGCTGCGGCG GGAGCCCATC ACCACCAGAA CACGATGGCA 
0241 GTGGCCGC-T TCCCAGGCCG CCAGTTTGGC CGGTTTGCAT CCAGCAAGCT GGTGGTCAAT 
0301 GGCCCAGTTA GCTGCCCAGG ATTACTTCAG TCGCCTGCAA GCCTCGGGTC TTTCCCCCTT 
0361 TCCAC-ATCC CGATCTGGCG GCTGCCTTTG GACCAGCTGG GATGGGAATG GGCGGCGGTG 
0421 CTGGTGGAGC GGGTGCTGGA GGTGGTGGAG CAGGTGTACT CGGCCAGGGC GGCGGTGGAA 
0481 ATGGCGGAAG TGGCAACGGT GGTGGTGGAT CCTCATCGGG TT 
 Assemble Data

10897R-4.IR_full       1   CACGACCCCACCGGCCTTTTAGATGCAGCTTCCCTGTTCGCTTACTGGGGACGTGATCCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     1   CACGACCCCACCGGCCTTTTAGATGCAGCTTCCCTGTTCGCTTACTGGGGACGTGATCCA 60


10897R-4.IR_full       61  ACTGGAGCGGCGGCTGCAGCGGCTTCCAATCCGCTCTTCAACTCGCAGTTCAATGCCGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     61  ACTGGAGCGGCGGCTGCAGCGGCTTCCAATCCGCTCTTCAACTCGCAGTTCAATGCCGCC 120


10897R-4.IR_full       121 GCTGCTGCCGGATTGGGTTTATTGCCACAAGCTGGAGGCGCCTCTGCCAATGACCGTTAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     121 GCTGCTGCCGGATTGGGTTTATTGCCACAAGCTGGAGGCGCCTCTGCCAATGACCGTTAT 180


10897R-4.IR_full       181 TCCATGGCAGCAGCAGCGGCGGCTGCGGCGGGAGCCCATCACCACCAGAACACGATGGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     181 TCCATGGCAGCAGCAGCGGCGGCTGCGGCGGGAGCCCATCACCACCAGAACACGATGGCA 240


10897R-4.IR_full       241 GTGGCCGCTTTCCCAGGCCGCCAGTTTGGCCGGTTTGCATCCAGCAAGCTGGTGGTCAAT 300
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     241 GTGGCCGC-TTCCCAGGCCGCCAGTTTGGCCGGTTTGCATCCAGCAAGCTGGTGGTCAAT 300


10897R-4.IR_full       301 GGCCCAGTTAGCTGCCCAGGATTACTTCAGTCGCCTGCAAGCCTCGGGTCTTTCCCCCTT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     301 GGCCCAGTTAGCTGCCCAGGATTACTTCAGTCGCCTGCAAGCCTCGGGTCTTTCCCCCTT 360


10897R-4.IR_full       361 TCCACAATCCCGATCTGGCGGCTGCCTTTGGACCAGCTGGGATGGGAATGGGCGGCGGTG 420
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     361 TCCAC-ATCCCGATCTGGCGGCTGCCTTTGGACCAGCTGGGATGGGAATGGGCGGCGGTG 420


10897R-4.IR_full       421 CTGGTGGAGCGGGTGCTGGAGGTGGTGGAGCAGGTGTACTCGGCCAGGGCGGCGGTGGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     421 CTGGTGGAGCGGGTGCTGGAGGTGGTGGAGCAGGTGTACTCGGCCAGGGCGGCGGTGGAA 480


10897R-4.IR_full       481 ATGGCGGAAGTGGCAACGGTGGTGGTGGATCCTCATCGGGTT 522
                           ||||||||||||||||||||||||||||||||||||||||||
10897R-4.in silico     481 ATGGCGGAAGTGGCAACGGTGGTGGTGGATCCTCATCGGGTT 522

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   502  12  52  NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0.39   14  93  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0.39   30  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0.39   10  37  NM_057896.3  CG14938-RC, transcript variant C (crol), mRNA 
0.39   10  37  NM_057895.3  CG14938-RA, transcript variant A (crol), mRNA 
0.39   10  37  NM_057897.3  CG14938-RB, transcript variant B (crol), mRNA 
0.39   32  NM_164971.1  CG14938-RD, transcript variant D (crol), mRNA 
0.19   17  77  NM_168113.2  CG32423-RD, transcript variant D (alan-shepard), mRNA 
0.19   22  NM_168111.3  CG32423-RA, transcript variant A (alan-shepard), mRNA 
0.19   18  NM_168112.1  CG32423-RB, transcript variant B (alan-shepard), mRNA 
0.19   20  NM_140154.1  CG12523-RA (CG12523), mRNA 
0.19   NM_166341.1  CG30127-RA (CG30127), mRNA 
0.19   37  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0.19   35  NM_170054.2  CG17894-RB, transcript variant B (cnc), mRNA 
0.19   NM_057853.2  CG2189-RA (Dfd), mRNA 
0   11  12  38  NM_078976.3  CG9015-RA, transcript variant A (en), mRNA 
0   11  12  38  NM_165841.1  CG9015-RB, transcript variant B (en), mRNA 
0   10  29  70  NM_164716.1  CG31632-RA (CG31632), mRNA 
0   37  94  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
0   37  94  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
0   28  47  NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   28  47  NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   12  58  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   12  58  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   13  48  NM_132246.2  CG10555-RA (CG10555), mRNA 
0   12  62  NM_080340.2  CG2302-RA (nAcRalpha-7E), mRNA 
0   35  NM_165327.1  CG10043-RB, transcript variant B (rtGEF), mRNA 
0   35  NM_057826.3  CG10043-RA, transcript variant A (rtGEF), mRNA 
0   17  46  NM_136191.2  CG31688-RA (CG31688), mRNA 
0   14  71  NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.