National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10897R-1 
 Symbol tou  Full Name toutatis 
 CG No CG10897  Old CG No CG10897 
 Synonyms Dm Tou, CG10897, gene VI, VI, EP(2)0622, EP622, anon-48Ad, EP0622, tou, transcript group VI, toutatis 
 Accession No (Link to NCBI) NM_078977.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CACGACCCCACCGGCCTTTTAGATGCAGCTTCCCTGTTCGCTTACTGGGGACGTGATCCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACTGGAGCGGCGGCTGCAGCGGCTTCCAATCCGCTCTTCAACTCGCAGTTCAATGCCGCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTGCTGCCGGATTGGGTTTATTGCCACAAGCTGGAGGCGCCTCTGCCAATGACCGTTAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCATGGCAGCAGCAGCGGCGGCTGCGGCGGGAGCCCATCACCACCAGAACACGATGGCA 240

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTGGCCGC-TTCCCAGGCCGCCAGTTTGGCCGGTTTGCATCCAGCAAGCTGGTGGTCAAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCCCAGTTAGCTGCCCAGGATTACTTCAGTCGCCTGCAAGCCTCGGGTCTTTCCCCCTT 360

                           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCAC-ATCCCGATCTGGCGGCTGCCTTTGGACCAGCTGGGATGGGAATGGGCGGCGGTG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTGGTGGAGCGGGTGCTGGAGGTGGTGGAGCAGGTGTACTCGGCCAGGGCGGCGGTGGAA 480

                           |||||||||||||||||||||||||||||||||||||||||| silico     481 ATGGCGGAAGTGGCAACGGTGGTGGTGGATCCTCATCGGGTT 522

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   502  12  52  NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0.39   14  93  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0.39   30  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0.39   10  37  NM_057896.3  CG14938-RC, transcript variant C (crol), mRNA 
0.39   10  37  NM_057895.3  CG14938-RA, transcript variant A (crol), mRNA 
0.39   10  37  NM_057897.3  CG14938-RB, transcript variant B (crol), mRNA 
0.39   32  NM_164971.1  CG14938-RD, transcript variant D (crol), mRNA 
0.19   17  77  NM_168113.2  CG32423-RD, transcript variant D (alan-shepard), mRNA 
0.19   22  NM_168111.3  CG32423-RA, transcript variant A (alan-shepard), mRNA 
0.19   18  NM_168112.1  CG32423-RB, transcript variant B (alan-shepard), mRNA 
0.19   20  NM_140154.1  CG12523-RA (CG12523), mRNA 
0.19   NM_166341.1  CG30127-RA (CG30127), mRNA 
0.19   37  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0.19   35  NM_170054.2  CG17894-RB, transcript variant B (cnc), mRNA 
0.19   NM_057853.2  CG2189-RA (Dfd), mRNA 
0   11  12  38  NM_078976.3  CG9015-RA, transcript variant A (en), mRNA 
0   11  12  38  NM_165841.1  CG9015-RB, transcript variant B (en), mRNA 
0   10  29  70  NM_164716.1  CG31632-RA (CG31632), mRNA 
0   37  94  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
0   37  94  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
0   28  47  NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   28  47  NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   12  58  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   12  58  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   13  48  NM_132246.2  CG10555-RA (CG10555), mRNA 
0   12  62  NM_080340.2  CG2302-RA (nAcRalpha-7E), mRNA 
0   35  NM_165327.1  CG10043-RB, transcript variant B (rtGEF), mRNA 
0   35  NM_057826.3  CG10043-RA, transcript variant A (rtGEF), mRNA 
0   17  46  NM_136191.2  CG31688-RA (CG31688), mRNA 
0   14  71  NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.