National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10802R-3 
 Symbol CG10802  Full Name CG10802 
 CG No CG10802  Old CG No CG10802 
 Synonyms anon-EST:Posey113, CG10802 
 Accession No (Link to NCBI) NM_130706.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GTTCAAGTGCCAGGAGGACAGTTTCCTGAAGGAGTTCAAGACAAAAATCGTTAGCAGCGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GTTTGCCACCTTGGATTGGACAGATCCCAGTGGAAAGGTGGAGAAACTCAAGGGCTTCAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     121 TGTGATCTGCGAGGACACGATACTATTTCCCGAGGGCGGTGGTCAGCCCTGCGA-TTACG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAACCTTAGGCGGATTTCCAGTTAAGAATGTCCAGAGAAAAGGCTCTACGGCTGTACATT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTGTGGAATCCCCAACGAGTTTCGAGCAGGATGCCGAAGTCCTTCTGACACTAGACTACC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AAAGAAGACTGGATCACATGCAACAGCACTCAGGACAGCACCTGATCACCGCCCTGTTCG 360

                           ||||||||||||||||||||  |||||||||||||||||||||||||||||||||||||| silico     361 ACAGGGAGTTCAAGTACGATACCACCTCGTGGTCCCTGGGATCCACTGTCTCTTACATTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AATTAAGTACGCCTCATTTGATAAGTCGCGAGTCATTGGACCTCATCGAACGTCAGGCCA 480

10802R-3.IR_full       481 ACGATCTGATTCGCGAGGGCC 501
                           ||||||||||||||||||||| silico     481 ACGATCTGATTCGCGAGGGCC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130706.2  CG10802-RA (CG10802), mRNA 
0   NM_142872.1  CG13829-RA (CG13829), mRNA 
0   NM_135772.1  CG9426-RA (CG9426), mRNA 
0   NM_132315.1  CG12120-RA (CG12120), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   NM_141598.2  CG11977-RA (CG11977), mRNA 
0   NM_143530.2  CG2217-RA (CG2217), mRNA 
0   NM_143290.1  CG17991-RA (CG17991), mRNA 
0   NM_143665.2  CG2041-RA (lgs), mRNA 
0   NM_132417.1  CG12637-RA (CG12637), mRNA 
0   NM_001032055.1  CG17291-RB, transcript variant B (Pp2A-29B), mRNA 
0   NM_001032056.1  CG17291-RA, transcript variant A (Pp2A-29B), mRNA 
0   NM_140842.1  CG9629-RA (CG9629), mRNA 
0   NM_130604.2  CG17766-RA (CG17766), mRNA 
0   NM_079713.2  CG6376-RA, transcript variant A (E2f), mRNA 
0   NM_169961.1  CG6376-RB, transcript variant B (E2f), mRNA 
0   NM_169962.1  CG6376-RC, transcript variant C (E2f), mRNA 
0   NM_078592.2  CG11172-RA (NFAT), mRNA 
0   NM_001014586.2  CG4609-RD, transcript variant D (fax), mRNA 
0   NM_079382.5  CG4609-RA, transcript variant A (fax), mRNA 
0   NM_176336.3  CG4609-RB, transcript variant B (fax), mRNA 
0   NM_001014587.2  CG4609-RC, transcript variant C (fax), mRNA 
0   NM_166290.1  CG30120-RA (CG30120), mRNA 
0   NM_176368.1  CG6571-RD, transcript variant D (rdgC), mRNA 
0   NM_176367.1  CG6571-RC, transcript variant C (rdgC), mRNA 
0   NM_176366.1  CG6571-RB, transcript variant B (rdgC), mRNA 
0   NM_143689.1  CG11093-RA (CG11093), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_134534.2  CG17052-RA (CG17052), mRNA 
0   NM_176118.1  CG2249-RB, transcript variant B (CG2249), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.