National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10802R-1 
 Symbol CG10802  Full Name CG10802 
 CG No CG10802  Old CG No CG10802 
 Synonyms anon-EST:Posey113, CG10802 
 Accession No (Link to NCBI) NM_130706.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTCAAGTGCCAGGAGGACAG 
 Primer Seq. 3'
aatctagaggtaccGGCCCTCGCGAATCAGATCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTCAAGTGC CAGGAGGACA GTTTCCTGAA GGAGTTCAAG ACAAAAATCG TTAGCAGCGA 
0061 GTTTGCCACC TTGGATTGGA CAGATCCCAG TGGAAAGGTG GAGAAACTCA AGGGCTTCAA 
0121 TGTGATCTGC GAGGACACGA TACTATTTCC CGAGGGCGGT GGTCAGCCCT GCGANTTACG 
0181 GAACCTTAGG CGGATTTCCA GTTAAGAATG TCCAGAGAAA AGGCTCTACG GCTGTACATT 
0241 TTGTGGAATC CCCAACGAGT TTCGAGCAGG ATGCCGAAGT CCTTCTGACA CTAGACTACC 
0301 AAAGAAGACT GGATCACATG CAACAGCACT CAGGACAGCA CCTGATCACC GCCCTGTTCG 
0361 ACAGGGAGTT CAAGTACGAT NNCACCTCGT GGTCCCTGGG ATCCACTGTC TCTTACATTC 
0421 AATTAAGTAC GCCTCATTTG ATAAGTCGCG AGTCATTGGA CCTCATCGAA CGTCAGGCCA 
0481 ACGATCTGAT TCGCGAGGGC C 
 in silico PCR Fragment
0001 GTTCAAGTGC CAGGAGGACA GTTTCCTGAA GGAGTTCAAG ACAAAAATCG TTAGCAGCGA 
0061 GTTTGCCACC TTGGATTGGA CAGATCCCAG TGGAAAGGTG GAGAAACTCA AGGGCTTCAA 
0121 TGTGATCTGC GAGGACACGA TACTATTTCC CGAGGGCGGT GGTCAGCCCT GCGA-TTACG 
0181 GAACCTTAGG CGGATTTCCA GTTAAGAATG TCCAGAGAAA AGGCTCTACG GCTGTACATT 
0241 TTGTGGAATC CCCAACGAGT TTCGAGCAGG ATGCCGAAGT CCTTCTGACA CTAGACTACC 
0301 AAAGAAGACT GGATCACATG CAACAGCACT CAGGACAGCA CCTGATCACC GCCCTGTTCG 
0361 ACAGGGAGTT CAAGTACGAT ACCACCTCGT GGTCCCTGGG ATCCACTGTC TCTTACATTC 
0421 AATTAAGTAC GCCTCATTTG ATAAGTCGCG AGTCATTGGA CCTCATCGAA CGTCAGGCCA 
0481 ACGATCTGAT TCGCGAGGGC C 
 Assemble Data

10802R-1.IR_full       1   GTTCAAGTGCCAGGAGGACAGTTTCCTGAAGGAGTTCAAGACAAAAATCGTTAGCAGCGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10802R-1.in silico     1   GTTCAAGTGCCAGGAGGACAGTTTCCTGAAGGAGTTCAAGACAAAAATCGTTAGCAGCGA 60


10802R-1.IR_full       61  GTTTGCCACCTTGGATTGGACAGATCCCAGTGGAAAGGTGGAGAAACTCAAGGGCTTCAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10802R-1.in silico     61  GTTTGCCACCTTGGATTGGACAGATCCCAGTGGAAAGGTGGAGAAACTCAAGGGCTTCAA 120


10802R-1.IR_full       121 TGTGATCTGCGAGGACACGATACTATTTCCCGAGGGCGGTGGTCAGCCCTGCGANTTACG 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
10802R-1.in silico     121 TGTGATCTGCGAGGACACGATACTATTTCCCGAGGGCGGTGGTCAGCCCTGCGA-TTACG 180


10802R-1.IR_full       181 GAACCTTAGGCGGATTTCCAGTTAAGAATGTCCAGAGAAAAGGCTCTACGGCTGTACATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10802R-1.in silico     181 GAACCTTAGGCGGATTTCCAGTTAAGAATGTCCAGAGAAAAGGCTCTACGGCTGTACATT 240


10802R-1.IR_full       241 TTGTGGAATCCCCAACGAGTTTCGAGCAGGATGCCGAAGTCCTTCTGACACTAGACTACC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10802R-1.in silico     241 TTGTGGAATCCCCAACGAGTTTCGAGCAGGATGCCGAAGTCCTTCTGACACTAGACTACC 300


10802R-1.IR_full       301 AAAGAAGACTGGATCACATGCAACAGCACTCAGGACAGCACCTGATCACCGCCCTGTTCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10802R-1.in silico     301 AAAGAAGACTGGATCACATGCAACAGCACTCAGGACAGCACCTGATCACCGCCCTGTTCG 360


10802R-1.IR_full       361 ACAGGGAGTTCAAGTACGATNNCACCTCGTGGTCCCTGGGATCCACTGTCTCTTACATTC 420
                           ||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||
10802R-1.in silico     361 ACAGGGAGTTCAAGTACGATACCACCTCGTGGTCCCTGGGATCCACTGTCTCTTACATTC 420


10802R-1.IR_full       421 AATTAAGTACGCCTCATTTGATAAGTCGCGAGTCATTGGACCTCATCGAACGTCAGGCCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10802R-1.in silico     421 AATTAAGTACGCCTCATTTGATAAGTCGCGAGTCATTGGACCTCATCGAACGTCAGGCCA 480


10802R-1.IR_full       481 ACGATCTGATTCGCGAGGGCC 501
                           |||||||||||||||||||||
10802R-1.in silico     481 ACGATCTGATTCGCGAGGGCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130706.2  CG10802-RA (CG10802), mRNA 
0   NM_142872.1  CG13829-RA (CG13829), mRNA 
0   NM_135772.1  CG9426-RA (CG9426), mRNA 
0   NM_132315.1  CG12120-RA (CG12120), mRNA 
0   NM_169609.1  CG31304-RA (CG31304), mRNA 
0   NM_141598.2  CG11977-RA (CG11977), mRNA 
0   NM_143530.2  CG2217-RA (CG2217), mRNA 
0   NM_143290.1  CG17991-RA (CG17991), mRNA 
0   NM_143665.2  CG2041-RA (lgs), mRNA 
0   NM_132417.1  CG12637-RA (CG12637), mRNA 
0   NM_001032055.1  CG17291-RB, transcript variant B (Pp2A-29B), mRNA 
0   NM_001032056.1  CG17291-RA, transcript variant A (Pp2A-29B), mRNA 
0   NM_140842.1  CG9629-RA (CG9629), mRNA 
0   NM_130604.2  CG17766-RA (CG17766), mRNA 
0   NM_079713.2  CG6376-RA, transcript variant A (E2f), mRNA 
0   NM_169961.1  CG6376-RB, transcript variant B (E2f), mRNA 
0   NM_169962.1  CG6376-RC, transcript variant C (E2f), mRNA 
0   NM_078592.2  CG11172-RA (NFAT), mRNA 
0   NM_001014586.2  CG4609-RD, transcript variant D (fax), mRNA 
0   NM_079382.5  CG4609-RA, transcript variant A (fax), mRNA 
0   NM_176336.3  CG4609-RB, transcript variant B (fax), mRNA 
0   NM_001014587.2  CG4609-RC, transcript variant C (fax), mRNA 
0   NM_166290.1  CG30120-RA (CG30120), mRNA 
0   NM_176368.1  CG6571-RD, transcript variant D (rdgC), mRNA 
0   NM_176367.1  CG6571-RC, transcript variant C (rdgC), mRNA 
0   NM_176366.1  CG6571-RB, transcript variant B (rdgC), mRNA 
0   NM_143689.1  CG11093-RA (CG11093), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_134534.2  CG17052-RA (CG17052), mRNA 
0   NM_176118.1  CG2249-RB, transcript variant B (CG2249), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.