National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10801R-2 
 Symbol CG10801  Full Name CG10801 
 CG No CG10801  Old CG No CG10801 
 Synonyms CG10801 
 Accession No (Link to NCBI) NM_130702.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGCATCTACGAATGGATGCT 
 Primer Seq. 3'
aatctagaggtaccTTTCGCCGATGCGATCGTTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGCATCTAC GAATGGATGC TGAACGAGGA GAAAACCTTT GTCGTTGGCC AAAATCTAAT 
0061 ATCATTCTAT GCCGCAGCCC ATTGGCTGGG CGTTCANCAA TTGATAAAAC AGGCCTGGTC 
0121 CACCTTTTCG GCAGATGGAG TTTATGACAT TTGGGAAATA AATGCCTTTC AAGCCTACAT 
0181 CATGGCCAAG GATTATCGCT GCCCGGAGAT TATGATTGTA ATGCANATCG CGTTTGCGAA 
0241 AATGCTTTCT ACCAATTGTG GCATCTTGGG AGTTTCTCGA ATTCGATGTG AATGAAGTGA 
0301 CCACTTTGCT GGAACAAGAC ATGCTGTGTG TTAATAGTGA GGATGAGATT TTCTTCGCCG 
0361 TCTTTCACTG GTTGAATTAC TCCTGGACGG AACGCAAGAA GCACGCGGTC AAGGTGATGC 
0421 AAAAAGTCCG TTTTGGACTC CTGTCACCCT GGTTGCGTCG ATCCATTTGT AATATGCCCG 
0481 AAAACGATCG CATCGGCGAA A 
 in silico PCR Fragment
0001 ACGCATCTAC GAATGGATGC TGAACGAGGA GAAAACCTTT GTCGTTGGCC AAAATCTAAT 
0061 ATCATTCTAT GCCGCAGCCC ATTGGCTGGG CGTTCACCAA TTGATAAAAC AGGCCTGGTC 
0121 CACCTTTTCG GCAGATGGAG TTTATGACAT TTGGGAAATA AATGCCTTTC AAGCCTACAT 
0181 CATGGCCAAG GATTATCGCT GCCCGGAGAT TATGATTGTA ATGCA-ATCG CGTTTGCGAA 
0241 AATGCTTTCT ACCAATTGTG GCATCTTGGG AGTTTCTCGA ATTCGATGTG AATGAAGTGA 
0301 CCACTTTGCT GGAACAAGAC ATGCTGTGTG TTAATAGTGA GGATGAGATT TTCTTCGCCG 
0361 TCTTTCACTG GTTGAATTAC TCCTGGACGG AACGCAAGAA GCACGCGGTC AAGGTGATGC 
0421 AAAAAGTACG TTTTGGACTC CTGTCACCCT GGTTGCGTCG ATCCATTTGT AATATGCCCG 
0481 AAAACGATCG CATCGGCGAA A 
 Assemble Data

10801R-2.IR_full       1   ACGCATCTACGAATGGATGCTGAACGAGGAGAAAACCTTTGTCGTTGGCCAAAATCTAAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10801R-2.in silico     1   ACGCATCTACGAATGGATGCTGAACGAGGAGAAAACCTTTGTCGTTGGCCAAAATCTAAT 60


10801R-2.IR_full       61  ATCATTCTATGCCGCAGCCCATTGGCTGGGCGTTCANCAATTGATAAAACAGGCCTGGTC 120
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
10801R-2.in silico     61  ATCATTCTATGCCGCAGCCCATTGGCTGGGCGTTCACCAATTGATAAAACAGGCCTGGTC 120


10801R-2.IR_full       121 CACCTTTTCGGCAGATGGAGTTTATGACATTTGGGAAATAAATGCCTTTCAAGCCTACAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10801R-2.in silico     121 CACCTTTTCGGCAGATGGAGTTTATGACATTTGGGAAATAAATGCCTTTCAAGCCTACAT 180


10801R-2.IR_full       181 CATGGCCAAGGATTATCGCTGCCCGGAGATTATGATTGTAATGCANATCGCGTTTGCGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
10801R-2.in silico     181 CATGGCCAAGGATTATCGCTGCCCGGAGATTATGATTGTAATGCA-ATCGCGTTTGCGAA 240


10801R-2.IR_full       241 AATGCTTTCTACCAATTGTGGCATCTTGGGAGTTTCTCGAATTCGATGTGAATGAAGTGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10801R-2.in silico     241 AATGCTTTCTACCAATTGTGGCATCTTGGGAGTTTCTCGAATTCGATGTGAATGAAGTGA 300


10801R-2.IR_full       301 CCACTTTGCTGGAACAAGACATGCTGTGTGTTAATAGTGAGGATGAGATTTTCTTCGCCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10801R-2.in silico     301 CCACTTTGCTGGAACAAGACATGCTGTGTGTTAATAGTGAGGATGAGATTTTCTTCGCCG 360


10801R-2.IR_full       361 TCTTTCACTGGTTGAATTACTCCTGGACGGAACGCAAGAAGCACGCGGTCAAGGTGATGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10801R-2.in silico     361 TCTTTCACTGGTTGAATTACTCCTGGACGGAACGCAAGAAGCACGCGGTCAAGGTGATGC 420


10801R-2.IR_full       421 AAAAAGTCCGTTTTGGACTCCTGTCACCCTGGTTGCGTCGATCCATTTGTAATATGCCCG 480
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
10801R-2.in silico     421 AAAAAGTACGTTTTGGACTCCTGTCACCCTGGTTGCGTCGATCCATTTGTAATATGCCCG 480


10801R-2.IR_full       481 AAAACGATCGCATCGGCGAAA 501
                           |||||||||||||||||||||
10801R-2.in silico     481 AAAACGATCGCATCGGCGAAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130702.1  CG10801-RA (CG10801), mRNA 
0   NM_137448.2  CG5756-RA, transcript variant A (CG5756), mRNA 
0   NM_166262.1  CG5756-RB, transcript variant B (CG5756), mRNA 
0   NM_144368.2  CG4739-RA (Ugt86Dc), mRNA 
0   NM_169383.1  CG17734-RB, transcript variant B (CG17734), mRNA 
0   NM_141806.2  CG17734-RA, transcript variant A (CG17734), mRNA 
0   NM_132081.2  CG15896-RA (CG15896), mRNA 
0   NM_080254.2  CG6392-RA (cmet), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_140280.2  CG5688-RA (Grip163), mRNA 
0   NM_136451.1  CG2137-RA (CG2137), mRNA 
0   NM_130709.1  CG14271-RB (Gas8), mRNA 
0   NM_168961.2  CG32451-RB, transcript variant B (SPoCk), mRNA 
0   NM_168963.1  CG32451-RA, transcript variant A (SPoCk), mRNA 
0   NM_168962.1  CG32451-RC, transcript variant C (SPoCk), mRNA 
0   NM_140028.1  CG4911-RA (CG4911), mRNA 
0   NM_136849.1  CG30035-RA, transcript variant A (CG30035), mRNA 
0   NM_135634.1  CG16840-RA (Art8), mRNA 
0   NM_137831.2  CG4752-RA (CG4752), mRNA 
0   NM_141196.1  CG9778-RA (CG9778), mRNA 
0   NM_135320.2  CG7093-RA (CG7093), mRNA 
0   NM_001015220.1  CG41141-PA (CG41141), mRNA 
0   NM_135524.3  CG5640-RA, transcript variant A (CG5640), mRNA 
0   NM_164907.2  CG5640-RB, transcript variant B (CG5640), mRNA 
0   NM_164908.2  CG5640-RC, transcript variant C (CG5640), mRNA 
0   NM_169384.2  CG31386-RA (CG31386), mRNA 
0   NM_137143.1  CG12857-RA (CG12857), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_141709.2  CG5359-RA (CG5359), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.