National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10777R-3 
 Symbol CG10777  Full Name CG10777 
 CG No CG10777  Old CG No CG10777 
 Synonyms DmRH1, cg10777, CG10777 
 Accession No (Link to NCBI) NM_132196.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAAGCATGCACTTTGGTCAG 
 Primer Seq. 3'
aatctagaggtaccGGTAGTTCATTGCCAGACACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNAAGCATGC ACTTTGGTCA GCCCTATGGC GTCGATGACC TATGGCATCC AGAATGGTCT 
0061 GGGAATGGGA GCCGCCGGTT CTGGTGGCGG CAATCCGTAT CGCCAGCAAA ACGGTGTTGC 
0121 ATTCGCCGGT AATGGACTTG GAGGAGGCGC CGGTGGCGGA TCCGGAGGAT CTGGCGGATA 
0181 TGGAGGACAG CGTGGCAAAA ATCCAACCTA CGCACAGCGT TATCAGAAGC CGAACAACGG 
0241 CGCCGGAGTT GCTGGTGGCT ACCAAAGCAA TAACTACANA TGCTGCCGCC TTAGGCATGC 
0301 TTTCCAAAGA GGAGCGCGCC GAGATCCAAC GTGAAAAGGC CAAAAATCCC GGCCGAAATT 
0361 TAGTGAAACC CAAGTGGGNA GAACCTCGAG CCCTTCCTCA AAGATTTCTA CAACATTCAT 
0421 CCGAATACAC TGGCCAAATC AGAGCAGCAG GTgGNCGAGA TCCGGCGCGA ACTGGAAATC 
0481 ACCGTGTCTG GCAATGAACT ACC 
 in silico PCR Fragment
0001 GGAAGCATGC ACTTTGGTCA GCCCTATGGC GT-GATGACC TATGGCATCC AGAATGGTCT 
0061 GGGAATGGGA GCCGCCGGTT CTGGTGGCGG CAATCCGTAT CGCCAGCAAA ACGGTGTTGC 
0121 ATTCGCCGGT AATGGACTTG GAGGAGGCGC CGGTGGCGGA TCCGGAGGAT CTGGCGGATA 
0181 TGGAGGACAG CGTGGCAAAA ATCCAACCTA CGCACAGCGT TATCAGAAGC CGAACAACGG 
0241 CGCCGGAGTT GCTGGTGGCT ACCAAAGCAA TAACTACA-A TGCTGCCGCC TTAGGCATGC 
0301 TTTCCAAAGA GGAGCGCGCC GAGATCCAAC GTGAAAAGGC CAAAAATCCC GGCCGAAATT 
0361 TAGTGAAACC CAAGTGGG-A GAACCTCGAG CCCTTCCTCA AAGATTTCTA CAACATTCAT 
0421 CCGAATACAC TGGCCAAATC AGAGCAGCAG GTGGCCGAGA TCCGGCGCGA ACTGGAAATC 
0481 ACCGTGTCTG GCAATGAACT ACC 
 Assemble Data

10777R-3.IR_full       1   GNAAGCATGCACTTTGGTCAGCCCTATGGCGTCGATGACCTATGGCATCCAGAATGGTCT 60
                           | |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
10777R-3.in silico     1   GGAAGCATGCACTTTGGTCAGCCCTATGGCGT-GATGACCTATGGCATCCAGAATGGTCT 60


10777R-3.IR_full       61  GGGAATGGGAGCCGCCGGTTCTGGTGGCGGCAATCCGTATCGCCAGCAAAACGGTGTTGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10777R-3.in silico     61  GGGAATGGGAGCCGCCGGTTCTGGTGGCGGCAATCCGTATCGCCAGCAAAACGGTGTTGC 120


10777R-3.IR_full       121 ATTCGCCGGTAATGGACTTGGAGGAGGCGCCGGTGGCGGATCCGGAGGATCTGGCGGATA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10777R-3.in silico     121 ATTCGCCGGTAATGGACTTGGAGGAGGCGCCGGTGGCGGATCCGGAGGATCTGGCGGATA 180


10777R-3.IR_full       181 TGGAGGACAGCGTGGCAAAAATCCAACCTACGCACAGCGTTATCAGAAGCCGAACAACGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10777R-3.in silico     181 TGGAGGACAGCGTGGCAAAAATCCAACCTACGCACAGCGTTATCAGAAGCCGAACAACGG 240


10777R-3.IR_full       241 CGCCGGAGTTGCTGGTGGCTACCAAAGCAATAACTACANATGCTGCCGCCTTAGGCATGC 300
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
10777R-3.in silico     241 CGCCGGAGTTGCTGGTGGCTACCAAAGCAATAACTACA-ATGCTGCCGCCTTAGGCATGC 300


10777R-3.IR_full       301 TTTCCAAAGAGGAGCGCGCCGAGATCCAACGTGAAAAGGCCAAAAATCCCGGCCGAAATT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10777R-3.in silico     301 TTTCCAAAGAGGAGCGCGCCGAGATCCAACGTGAAAAGGCCAAAAATCCCGGCCGAAATT 360


10777R-3.IR_full       361 TAGTGAAACCCAAGTGGGNAGAACCTCGAGCCCTTCCTCAAAGATTTCTACAACATTCAT 420
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
10777R-3.in silico     361 TAGTGAAACCCAAGTGGG-AGAACCTCGAGCCCTTCCTCAAAGATTTCTACAACATTCAT 420


10777R-3.IR_full       421 CCGAATACACTGGCCAAATCAGAGCAGCAGGTGGNCGAGATCCGGCGCGAACTGGAAATC 480
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
10777R-3.in silico     421 CCGAATACACTGGCCAAATCAGAGCAGCAGGTGGCCGAGATCCGGCGCGAACTGGAAATC 480


10777R-3.IR_full       481 ACCGTGTCTGGCAATGAACTACC 503
                           |||||||||||||||||||||||
10777R-3.in silico     481 ACCGTGTCTGGCAATGAACTACC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132196.2  CG10777-RB (CG10777), mRNA 
0.62   NM_001014541.1  CG8201-RM, transcript variant M (par-1), mRNA 
0.62   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 
0.62   NM_206176.2  CG8201-RD, transcript variant D (par-1), mRNA 
0.62   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0.62   NM_206168.2  CG8201-RO, transcript variant O (par-1), mRNA 
0.62   NM_206169.2  CG8201-RJ, transcript variant J (par-1), mRNA 
0.62   NM_206170.2  CG8201-RI, transcript variant I (par-1), mRNA 
0.62   NM_206171.2  CG8201-RH, transcript variant H (par-1), mRNA 
0.62   NM_001014540.1  CG8201-RN, transcript variant N (par-1), mRNA 
0.62   NM_001014542.1  CG8201-RL, transcript variant L (par-1), mRNA 
0.62   NM_206178.1  CG8201-RA, transcript variant A (par-1), mRNA 
0.62   NM_206177.1  CG8201-RB, transcript variant B (par-1), mRNA 
0.62   NM_206174.2  CG8201-RE, transcript variant E (par-1), mRNA 
0.62   NM_206172.1  CG8201-RG, transcript variant G (par-1), mRNA 
0   NM_001031944.1  CG4460-RA, transcript variant A (Hsp22), mRNA 
0   NM_001031945.1  CG4456-RB, transcript variant B (Hsp67Bb), mRNA 
0   NM_001031943.1  CG4460-RB, transcript variant B (Hsp22), mRNA 
0   10  42  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_206095.1  CG13214-RB, transcript variant B (CG13214), mRNA 
0   NM_078819.4  CG14916-RA (Gr32a), mRNA 
0   13  21  NM_142379.3  CG14329-RA (CG14329), mRNA 
0   NM_167644.1  CG32536-RA (CG32536), mRNA 
0   NM_136633.2  CG2072-RA (TXBP181-like), mRNA 
0   NM_140331.2  CG10627-RA (CG10627), mRNA 
0   10  NM_136997.1  CG15870-RA (CG15870), mRNA 
0   NM_142537.1  CG3773-RA (CG3773), mRNA 
0   NM_130709.1  CG14271-RB (Gas8), mRNA 
0   NM_079053.2  CG4921-RB, transcript variant B (Rab4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.