National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10742R-3 
 Symbol Tsp3A  Full Name Tetraspanin 3A 
 CG No CG10742  Old CG No CG10742 
 Synonyms CG10742, BACR7C10.6, EG:BACR7C10.6, Dm.Tsp3A, Tsp3A 
 Accession No (Link to NCBI) NM_080315.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Xu C, Franklin B, Tang HW, Regimbald-Dumas Y, Hu Y, Ramos J, Bosch JA, Villalta C, He X, Perrimon N.
An in vivo RNAi screen uncovers the role of AdoR signaling and adenosine deaminase in controlling intestinal stem cell activity.
Proc Natl Acad Sci U S A (2020) 117(1) 464-471 [ PubMed ID = 31852821 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTACCGATATCAGGGTGCTGG 
 Primer Seq. 3'
aatctagaggtaccGATCGTCGCGGTACGAGTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTACCGATAT CAGGGTGCTG GGNTCGGGGG CGTCGGCATG GCCGNGNGGC GTGGCTACAG 
0061 CGGCATCGAG GTGCACGAGG TGATGCATCC GCATCACTTC ACCTACGTGA GCCAGTGCGT 
0121 CAAGTACATG ATCTTCCTGC TGAACTTCGT GTTCTGGCTC TTTGGCGGCC TGCTCCTGGG 
0181 CATTGGCGTC TATGCGTTCA GGGACAAGTG GGAGGACGCG AACGGATCGG TGCGTNNTNG 
0241 AGAACTTCTA CGACGTATTC CTCAATATCT CGCTGGTGAT GATCCTGGCC GCGCACGGTC 
0301 ATCATTTCTG GTCAGCTTCT CCGGCTGCGT gNGNNNACTG CGCGAGAACA CATTCCTACT 
0361 GAAGTTCTAC TCCATGTGCC TGCTGCTTTT CTTCCTGCTG GAGATGGCCA TCGCCATCGT 
0421 CTGCTTCGTG TGCCCGCAGT ACATGAACAC NCNTTTTGGA GAAGCAGTTC ACGCACAAGA 
0481 TCATCCACTC GTACCGCGAC GATC 
 in silico PCR Fragment
0001 CTACCGATAT CAGGGTGCTG GGCTCGGGGG CGTCGGCATG GCCGGGGGGC GTGGCTACAG 
0061 CGGCATCGAG GTGCACGAGG TGATGCATCC GCATCACTTC ACCTACGTGA GCCAGTGCGT 
0121 CAAGTACATG ATCTTCCTGC TGAACTTCGT GTTCTGGCTC TTTGGCGGCC TGCTCCTGGG 
0181 CATTGGCGTC TATGCGTTCA GGGACAAGTG GGAGGACGCG AACGGATCGG TGCG-GCTGG 
0241 AGAACTTCTA CGACGTATTC CTCAATATCT CGCTGGTGAT GATCCTGGCC G-GCACGGTC 
0301 ATC-TTTCTG GTCAGCTTCT CCGGCTGCGT GGGCGCACTG CGCGAGAACA CATTCCTACT 
0361 GAAGTTCTAC TCCATGTGCC TGCTGCTTTT CTTCCTGCTG GAGATGGCCA TCGCCATCGT 
0421 CTGCTTCGTG TGCCCGCAGT ACATGAACAC -CTTTTTGGA GAAGCAGTTC ACGCACAAGA 
0481 TCATCCACTC GTACCGCGAC GATC 
 Assemble Data

10742R-3.IR_full       1   CTACCGATATCAGGGTGCTGGGNTCGGGGGCGTCGGCATGGCCGNGNGGCGTGGCTACAG 60
                           |||||||||||||||||||||| ||||||||||||||||||||| | |||||||||||||
10742R-3.in silico     1   CTACCGATATCAGGGTGCTGGGCTCGGGGGCGTCGGCATGGCCGGGGGGCGTGGCTACAG 60


10742R-3.IR_full       61  CGGCATCGAGGTGCACGAGGTGATGCATCCGCATCACTTCACCTACGTGAGCCAGTGCGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10742R-3.in silico     61  CGGCATCGAGGTGCACGAGGTGATGCATCCGCATCACTTCACCTACGTGAGCCAGTGCGT 120


10742R-3.IR_full       121 CAAGTACATGATCTTCCTGCTGAACTTCGTGTTCTGGCTCTTTGGCGGCCTGCTCCTGGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10742R-3.in silico     121 CAAGTACATGATCTTCCTGCTGAACTTCGTGTTCTGGCTCTTTGGCGGCCTGCTCCTGGG 180


10742R-3.IR_full       181 CATTGGCGTCTATGCGTTCAGGGACAAGTGGGAGGACGCGAACGGATCGGTGCGTNNTNG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||   | |
10742R-3.in silico     181 CATTGGCGTCTATGCGTTCAGGGACAAGTGGGAGGACGCGAACGGATCGGTGCG-GCTGG 240


10742R-3.IR_full       241 AGAACTTCTACGACGTATTCCTCAATATCTCGCTGGTGATGATCCTGGCCGCGCACGGTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
10742R-3.in silico     241 AGAACTTCTACGACGTATTCCTCAATATCTCGCTGGTGATGATCCTGGCCG-GCACGGTC 300


10742R-3.IR_full       301 ATCATTTCTGGTCAGCTTCTCCGGCTGCGTGNGNNNACTGCGCGAGAACACATTCCTACT 360
                           ||| ||||||||||||||||||||||||||| |   ||||||||||||||||||||||||
10742R-3.in silico     301 ATC-TTTCTGGTCAGCTTCTCCGGCTGCGTGGGCGCACTGCGCGAGAACACATTCCTACT 360


10742R-3.IR_full       361 GAAGTTCTACTCCATGTGCCTGCTGCTTTTCTTCCTGCTGGAGATGGCCATCGCCATCGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10742R-3.in silico     361 GAAGTTCTACTCCATGTGCCTGCTGCTTTTCTTCCTGCTGGAGATGGCCATCGCCATCGT 420


10742R-3.IR_full       421 CTGCTTCGTGTGCCCGCAGTACATGAACACNCNTTTTGGAGAAGCAGTTCACGCACAAGA 480
                           |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||
10742R-3.in silico     421 CTGCTTCGTGTGCCCGCAGTACATGAACAC-CTTTTTGGAGAAGCAGTTCACGCACAAGA 480


10742R-3.IR_full       481 TCATCCACTCGTACCGCGACGATC 504
                           ||||||||||||||||||||||||
10742R-3.in silico     481 TCATCCACTCGTACCGCGACGATC 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080315.2  CG10742-RA (Tsp3A), mRNA 
1.65   32  77  65  NM_079585.2  CG4591-RA (Tsp86D), mRNA 
0   NM_165005.1  CG31762-RD, transcript variant D (aret), mRNA 
0   NM_132290.1  CG7267-RB (CG7267), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0   NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0   NM_170095.1  CG31141-RA (CG31141), mRNA 
0   NM_167240.1  CG1799-RA, transcript variant A (ras), mRNA 
0   NM_079907.4  CG1799-RB, transcript variant B (ras), mRNA 
0   NM_167241.1  CG1799-RC, transcript variant C (ras), mRNA 
0   NM_168695.2  CG11905-RB, transcript variant B (CG11905), mRNA 
0   NM_168696.2  CG11905-RF, transcript variant F (CG11905), mRNA 
0   NM_144110.1  CG16836-RA (CG16836), mRNA 
0   NM_078543.2  CG15793-RA (Dsor1), mRNA 
0   NM_134787.2  CG31670-RA (CG31670), mRNA 
0   NM_139421.3  CG5687-RA (CG5687), mRNA 
0   NM_079974.2  CG3870-RA (chrw), mRNA 
0   NM_164379.1  CG31920-RB (CG31920), mRNA 
0   NM_170320.1  CG31065-RA (CG31065), mRNA 
0   NM_166569.1  CG12781-RB, transcript variant B (nahoda), mRNA 
0   NM_079091.2  CG12781-RA, transcript variant A (nahoda), mRNA 
0   NM_167188.1  CG32703-RA (CG32703), mRNA 
0   NM_139394.1  CG18171-RA (CG18171), mRNA 
0   NM_132573.1  CG17788-RA (CG17788), mRNA 
0   NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_176494.2  CG10851-RG, transcript variant G (B52), mRNA 
0   NM_176492.2  CG10851-RD, transcript variant D (B52), mRNA 
0   NM_176493.2  CG10851-RF, transcript variant F (B52), mRNA 
0   NM_001014619.1  CG10851-RH, transcript variant H (B52), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.