National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10742R-2 
 Symbol Tsp3A  Full Name Tetraspanin 3A 
 CG No CG10742  Old CG No CG10742 
 Synonyms CG10742, BACR7C10.6, EG:BACR7C10.6, Dm.Tsp3A, Tsp3A 
 Accession No (Link to NCBI) NM_080315.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||| ||||||||||||||||||||| | ||||||||||||| silico     1   CTACCGATATCAGGGTGCTGGGCTCGGGGGCGTCGGCATGGCCGGGGGGCGTGGCTACAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGGCATCGAGGTGCACGAGGTGATGCATCCGCATCACTTCACCTACGTGAGCCAGTGCGT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAAGTACATGATCTTCCTGCTGAACTTCGTGTTCTGGCTCTTTGGCGGCCTGCTCCTGGG 180

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||   | | silico     181 CATTGGCGTCTATGCGTTCAGGGACAAGTGGGAGGACGCGAACGGATCGGTGCG-GCTGG 240

                           ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     241 AGAACTTCTACGACGTATTCCTCAATATCTCGCTGGTGATGATCCTGGCCG-GCACGGTC 300

                           ||| ||||||||||||||||||||||||||| |   |||||||||||||||||||||||| silico     301 ATC-TTTCTGGTCAGCTTCTCCGGCTGCGTGGGCGCACTGCGCGAGAACACATTCCTACT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAGTTCTACTCCATGTGCCTGCTGCTTTTCTTCCTGCTGGAGATGGCCATCGCCATCGT 420

                           |||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| silico     421 CTGCTTCGTGTGCCCGCAGTACATGAACAC-CTTTTTGGAGAAGCAGTTCACGCACAAGA 480

10742R-2.IR_full       481 TCATCCACTCGTACCGCGACGATC 504
                           |||||||||||||||||||||||| silico     481 TCATCCACTCGTACCGCGACGATC 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080315.2  CG10742-RA (Tsp3A), mRNA 
1.65   32  77  65  NM_079585.2  CG4591-RA (Tsp86D), mRNA 
0   NM_165005.1  CG31762-RD, transcript variant D (aret), mRNA 
0   NM_132290.1  CG7267-RB (CG7267), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0   NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0   NM_170095.1  CG31141-RA (CG31141), mRNA 
0   NM_167240.1  CG1799-RA, transcript variant A (ras), mRNA 
0   NM_079907.4  CG1799-RB, transcript variant B (ras), mRNA 
0   NM_167241.1  CG1799-RC, transcript variant C (ras), mRNA 
0   NM_168695.2  CG11905-RB, transcript variant B (CG11905), mRNA 
0   NM_168696.2  CG11905-RF, transcript variant F (CG11905), mRNA 
0   NM_144110.1  CG16836-RA (CG16836), mRNA 
0   NM_078543.2  CG15793-RA (Dsor1), mRNA 
0   NM_134787.2  CG31670-RA (CG31670), mRNA 
0   NM_139421.3  CG5687-RA (CG5687), mRNA 
0   NM_079974.2  CG3870-RA (chrw), mRNA 
0   NM_164379.1  CG31920-RB (CG31920), mRNA 
0   NM_170320.1  CG31065-RA (CG31065), mRNA 
0   NM_166569.1  CG12781-RB, transcript variant B (nahoda), mRNA 
0   NM_079091.2  CG12781-RA, transcript variant A (nahoda), mRNA 
0   NM_167188.1  CG32703-RA (CG32703), mRNA 
0   NM_139394.1  CG18171-RA (CG18171), mRNA 
0   NM_132573.1  CG17788-RA (CG17788), mRNA 
0   NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_176494.2  CG10851-RG, transcript variant G (B52), mRNA 
0   NM_176492.2  CG10851-RD, transcript variant D (B52), mRNA 
0   NM_176493.2  CG10851-RF, transcript variant F (B52), mRNA 
0   NM_001014619.1  CG10851-RH, transcript variant H (B52), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.