National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10697R-2 
 Symbol Ddc  Full Name Dopa decarboxylase 
 CG No CG10697  Old CG No CG10697 
 Synonyms DDC, CG10697, unnamed, ddc, AADC, 5-HT, fDDC, DdcDm, l(2)k02104, l(2)37Ch, l(2)37Bl, Ddc 
 Accession No (Link to NCBI) NM_078876.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCGCCGGAGTTCAAGGATTTTGCCAAGACAATGGTCGACTTTATAGCCGAATATCTGGAG 60

                           ||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| silico     61  AATATACGCGAAAGGCGCGTTCTGCCGGAAGTGAAGCCTGGCTACCTGAAGCCATTGATT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCGGATGCTGCGCCCGAGAAGCCGGAGAAGTGGCAGGATGTGATGCAGGACATCGAGCGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTCATCATGCCGGGCGTGACACACTGGCACAGTCCCAAGTTTCATGCCTACTTCCCCACG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCCAACTCGTATCCAGCGATCGTTGCGGACATGCTGAGTGGAGCGATTGCCTGCATCGGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTCACGTGGATCGCCAGTCCCGCGTGCACGGAACTCGAGGTGGTCATGATGGATTGGCTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCAAGATGCTGGAGCTGCCGGCAGAGTTCCTGGCCTGTTCGGGCGGCAAGGGTGGCGGT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTCATCCAGGGCACGGCCAGTGAGTCCACACTGGTGGCTCTGCTGGGAGCCAAGGCCAAG 480

10697R-2.IR_full       481 AAGTTGAAGGAGGTGAAGGA 500
                           |||||||||||||||||||| silico     481 AAGTTGAAGGAGGTGAAGGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
100   482  NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
100   482  NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_137994.2  CG5554-RA (CG5554), mRNA 
0   13  37  NM_057244.3  CG10501-RA, transcript variant A (amd), mRNA 
0   14  NM_165483.1  CG30446-RA (Tdc2), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_169015.1  CG31531-RB, transcript variant B (CG31531), mRNA 
0   NM_136673.2  CG1698-RA (CG1698), mRNA 
0   NM_131940.1  CG15912-RA (CG15912), mRNA 
0   NM_057310.3  CG5637-RA (nos), mRNA 
0   NM_058005.3  CG9738-RA (Mkk4), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_165541.1  CG30498-RA (boca), mRNA 
0   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 
0   NM_001014561.1  CG7524-RD, transcript variant D (Src64B), mRNA 
0   NM_080195.2  CG7524-RB, transcript variant B (Src64B), mRNA 
0   NM_001014564.1  CG7524-RE, transcript variant E (Src64B), mRNA 
0   NM_169030.1  CG2604-RC, transcript variant C (CG2604), mRNA 
0   NM_169029.1  CG2604-RB, transcript variant B (CG2604), mRNA 
0   NM_141260.2  CG2604-RA, transcript variant A (CG2604), mRNA 
0   NM_137960.2  CG3957-RA (CG3957), mRNA 
0   NM_057865.3  CG3324-RA (Pkg21D), mRNA 
0   10  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_078495.1  CG15779-RA (Tre), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.