National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10697R-1 
 Symbol Ddc  Full Name Dopa decarboxylase 
 CG No CG10697  Old CG No CG10697 
 Synonyms DDC, CG10697, unnamed, ddc, AADC, 5-HT, fDDC, DdcDm, l(2)k02104, l(2)37Ch, l(2)37Bl, Ddc 
 Accession No (Link to NCBI) NM_078876.4 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Sekine Y, Takagahara S, Hatanaka R, Watanabe T, Oguchi H, Noguchi T, Naguro I, Kobayashi K, Tsunoda M, Funatsu T, Nomura H, Toyoda T, Matsuki N, Kuranaga E, Miura M, Takeda K, Ichijo H.
p38 MAPKs regulate the expression of genes in the dopamine synthesis pathway through phosphorylation of NR4A nuclear receptors.
J. Cell. Sci. (2011) 124(Pt 17) 3006-16 [ PubMed ID = 21878507 ] [ RRC reference ]

Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGCCGGAGTTCAAGGATTTT 
 Primer Seq. 3'
aatctagaggtaccTCCTTCACCTCCTTCAACTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGCCGGAGT TCAAGGATTT TGCCAAGACA ATGGTCGACT TTATAGCCGA ATATCTGGAG 
0061 AATATACGCG AAAGGCGTGT TCTGCCGGAA GTGAAGCCTG GCTACCTGAA GCCACTGATT 
0121 CCGGATGCTG CGCCCGAGAA GCCGGAGAAG TGGCAGGATG TGATGCAGGA CATCGAGCGA 
0181 GTCATCATGC CGGGCGTGAC ACACTGGCAC AGTCCCAAGT TTCATGCCTA CTTCCCCACG 
0241 GCCAACTCGT ATCCAGCGAT CGTTGCGGAC ATGCTGAGTG GAGCGATTGC CTGCATCGGA 
0301 TTCACGTGGA TCGCCAGTCC CGCGTGCACG GAACTCGAGG TGGTCATGAT GGATTGGCTG 
0361 GGCAAGATGC TGGAGCTGCC GGCAGAGTTC CTGGCCTGTT CGGGCGGCAA GGGTGGCGGT 
0421 GTCATCCAGG GCACGGCCAG TGAGTCCACA CTGGTGGCTC TGCTGGGAGC CAAGGCCAAG 
0481 AAGTTGAAGG AGGTGAAGGA  
 in silico PCR Fragment
0001 GCGCCGGAGT TCAAGGATTT TGCCAAGACA ATGGTCGACT TTATAGCCGA ATATCTGGAG 
0061 AATATACGCG AAAGGCGCGT TCTGCCGGAA GTGAAGCCTG GCTACCTGAA GCCATTGATT 
0121 CCGGATGCTG CGCCCGAGAA GCCGGAGAAG TGGCAGGATG TGATGCAGGA CATCGAGCGA 
0181 GTCATCATGC CGGGCGTGAC ACACTGGCAC AGTCCCAAGT TTCATGCCTA CTTCCCCACG 
0241 GCCAACTCGT ATCCAGCGAT CGTTGCGGAC ATGCTGAGTG GAGCGATTGC CTGCATCGGA 
0301 TTCACGTGGA TCGCCAGTCC CGCGTGCACG GAACTCGAGG TGGTCATGAT GGATTGGCTG 
0361 GGCAAGATGC TGGAGCTGCC GGCAGAGTTC CTGGCCTGTT CGGGCGGCAA GGGTGGCGGT 
0421 GTCATCCAGG GCACGGCCAG TGAGTCCACA CTGGTGGCTC TGCTGGGAGC CAAGGCCAAG 
0481 AAGTTGAAGG AGGTGAAGGA  
 Assemble Data

10697R-1.IR_full       1   GCGCCGGAGTTCAAGGATTTTGCCAAGACAATGGTCGACTTTATAGCCGAATATCTGGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10697R-1.in silico     1   GCGCCGGAGTTCAAGGATTTTGCCAAGACAATGGTCGACTTTATAGCCGAATATCTGGAG 60


10697R-1.IR_full       61  AATATACGCGAAAGGCGTGTTCTGCCGGAAGTGAAGCCTGGCTACCTGAAGCCACTGATT 120
                           ||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||
10697R-1.in silico     61  AATATACGCGAAAGGCGCGTTCTGCCGGAAGTGAAGCCTGGCTACCTGAAGCCATTGATT 120


10697R-1.IR_full       121 CCGGATGCTGCGCCCGAGAAGCCGGAGAAGTGGCAGGATGTGATGCAGGACATCGAGCGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10697R-1.in silico     121 CCGGATGCTGCGCCCGAGAAGCCGGAGAAGTGGCAGGATGTGATGCAGGACATCGAGCGA 180


10697R-1.IR_full       181 GTCATCATGCCGGGCGTGACACACTGGCACAGTCCCAAGTTTCATGCCTACTTCCCCACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10697R-1.in silico     181 GTCATCATGCCGGGCGTGACACACTGGCACAGTCCCAAGTTTCATGCCTACTTCCCCACG 240


10697R-1.IR_full       241 GCCAACTCGTATCCAGCGATCGTTGCGGACATGCTGAGTGGAGCGATTGCCTGCATCGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10697R-1.in silico     241 GCCAACTCGTATCCAGCGATCGTTGCGGACATGCTGAGTGGAGCGATTGCCTGCATCGGA 300


10697R-1.IR_full       301 TTCACGTGGATCGCCAGTCCCGCGTGCACGGAACTCGAGGTGGTCATGATGGATTGGCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10697R-1.in silico     301 TTCACGTGGATCGCCAGTCCCGCGTGCACGGAACTCGAGGTGGTCATGATGGATTGGCTG 360


10697R-1.IR_full       361 GGCAAGATGCTGGAGCTGCCGGCAGAGTTCCTGGCCTGTTCGGGCGGCAAGGGTGGCGGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10697R-1.in silico     361 GGCAAGATGCTGGAGCTGCCGGCAGAGTTCCTGGCCTGTTCGGGCGGCAAGGGTGGCGGT 420


10697R-1.IR_full       421 GTCATCCAGGGCACGGCCAGTGAGTCCACACTGGTGGCTCTGCTGGGAGCCAAGGCCAAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10697R-1.in silico     421 GTCATCCAGGGCACGGCCAGTGAGTCCACACTGGTGGCTCTGCTGGGAGCCAAGGCCAAG 480


10697R-1.IR_full       481 AAGTTGAAGGAGGTGAAGGA 500
                           ||||||||||||||||||||
10697R-1.in silico     481 AAGTTGAAGGAGGTGAAGGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
100   482  NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
100   482  NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_137994.2  CG5554-RA (CG5554), mRNA 
0   13  37  NM_057244.3  CG10501-RA, transcript variant A (amd), mRNA 
0   14  NM_165483.1  CG30446-RA (Tdc2), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_169015.1  CG31531-RB, transcript variant B (CG31531), mRNA 
0   NM_136673.2  CG1698-RA (CG1698), mRNA 
0   NM_131940.1  CG15912-RA (CG15912), mRNA 
0   NM_057310.3  CG5637-RA (nos), mRNA 
0   NM_058005.3  CG9738-RA (Mkk4), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_165541.1  CG30498-RA (boca), mRNA 
0   NM_001014563.1  CG7524-RF, transcript variant F (Src64B), mRNA 
0   NM_001014562.1  CG7524-RC, transcript variant C (Src64B), mRNA 
0   NM_001014561.1  CG7524-RD, transcript variant D (Src64B), mRNA 
0   NM_080195.2  CG7524-RB, transcript variant B (Src64B), mRNA 
0   NM_001014564.1  CG7524-RE, transcript variant E (Src64B), mRNA 
0   NM_169030.1  CG2604-RC, transcript variant C (CG2604), mRNA 
0   NM_169029.1  CG2604-RB, transcript variant B (CG2604), mRNA 
0   NM_141260.2  CG2604-RA, transcript variant A (CG2604), mRNA 
0   NM_137960.2  CG3957-RA (CG3957), mRNA 
0   NM_057865.3  CG3324-RA (Pkg21D), mRNA 
0   10  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_078495.1  CG15779-RA (Tre), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.