National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10691R-1 
 Symbol l(2)37Cc  Full Name lethal (2) 37Cc 
 CG No CG10691  Old CG No CG10691 
 Synonyms Cc, l(2)Cc, fs(2)HH32, CG10691, l(2)37Cc 
 Accession No (Link to NCBI) NM_165281.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCAGCGGCCCATCATCTTC 
 Primer Seq. 3'
aatctagaggtaccTGACTTGGCCAACAGGCCAGC 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 NTGCAGcGGC CCATCATCTT CGACATCCGG TCCCAGCCCC GCAACGTTCC TGTGATAACG 
0061 GGCAGCAAGG ATCTGCAGAA TGTCAACATC ACGCTCCGAA TCCTGTACCG CCCCATTCCA 
0121 GACCAGCTGC CCAAGATCTA CACCATTNCT CGGCCAGGAC TACGACGAGC GTGTCCTGCC 
0181 CTCCATCGCG CCTGAGGTGC TGAAGGCTGT GGTCGCCCAG TTCGACGCCG GCGAGCTGAT 
0241 CACCCAGCGT GAGATGGTGT CGCAGCGCGT TTCCCAGGAA CTGACTGTAC GTGCCAAGCA 
0301 GTTCGGCTTT ATTCTGGATG ACATCTCGCT CACGCACTTG ACCTTCGGTC GGNGAGTTCA 
0361 CGCTGGCCGT CGAGATGAAG CAGGTGGCCC AGCAGGAGGC GGAGAAGGCG CNGTTTTGTC 
0421 GTGGAGAAGG CCGAGCAACA GAAGCTGGCG TCCATCATTT CGGCGGAGGG TGATGCCGAA 
0481 NCCGcNGNCC TGTTGGCCAA GTCA 
 in silico PCR Fragment
0001 GTGCAGCGGC CCATCATCTT CGACATCCGG TCCCAGCCCC GCAACGTTCC TGTGATAACG 
0061 GGCAGCAAGG ATCTGCAGAA TGTCAACATC ACGCTCCGAA TCCTGTACCG CCCCATTCCA 
0121 GACCAGCTGC CCAAGATCTA CACCATT-CT CGGCCAGGAC TACGACGAGC GTGTCCTGCC 
0181 CTCCATCGCG CCTGAGGTGC TGAAGGCTGT GGTCGCCCAG TTCGACGCCG GCGAGCTGAT 
0241 CACCCAGCGT GAGATGGTGT CGCAGCGCGT TTCCCAGGAA CTGACTGTAC GTGCCAAGCA 
0301 GTTCGGCTTT ATTCTGGATG ACATCTCGCT CACGCACTTG ACCTTCGGTC GG-GAGTTCA 
0361 CGCTGGCCGT CGAGATGAAG CAGGTGGCCC AGCAGGAGGC GGAGAAGGCG C-GTTTTGTC 
0421 GTGGAGAAGG CCGAGCAACA GAAGCTGGCG TCCATCATTT CGGCGGAGGG TGATGCCGAA 
0481 GCCGCTGGCC TGTTGGCCAA GTCA 
 Assemble Data

10691R-1.IR_full        1   TGCAGCGGCCCATCATCTTCGACATCCGGTCCCAGCCCCGCAACGTTCCTGTGATAACG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10691R-1.in silico      1   TGCAGCGGCCCATCATCTTCGACATCCGGTCCCAGCCCCGCAACGTTCCTGTGATAACG 59


10691R-1.IR_full       61  GGCAGCAAGGATCTGCAGAATGTCAACATCACGCTCCGAATCCTGTACCGCCCCATTCCA 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10691R-1.in silico     61  GGCAGCAAGGATCTGCAGAATGTCAACATCACGCTCCGAATCCTGTACCGCCCCATTCCA 119


10691R-1.IR_full       121 GACCAGCTGCCCAAGATCTACACCATTNCTCGGCCAGGACTACGACGAGCGTGTCCTGCC 179
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
10691R-1.in silico     121 GACCAGCTGCCCAAGATCTACACCATT-CTCGGCCAGGACTACGACGAGCGTGTCCTGCC 179


10691R-1.IR_full       181 CTCCATCGCGCCTGAGGTGCTGAAGGCTGTGGTCGCCCAGTTCGACGCCGGCGAGCTGAT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10691R-1.in silico     181 CTCCATCGCGCCTGAGGTGCTGAAGGCTGTGGTCGCCCAGTTCGACGCCGGCGAGCTGAT 239


10691R-1.IR_full       241 CACCCAGCGTGAGATGGTGTCGCAGCGCGTTTCCCAGGAACTGACTGTACGTGCCAAGCA 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10691R-1.in silico     241 CACCCAGCGTGAGATGGTGTCGCAGCGCGTTTCCCAGGAACTGACTGTACGTGCCAAGCA 299


10691R-1.IR_full       301 GTTCGGCTTTATTCTGGATGACATCTCGCTCACGCACTTGACCTTCGGTCGGNGAGTTCA 359
                           |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
10691R-1.in silico     301 GTTCGGCTTTATTCTGGATGACATCTCGCTCACGCACTTGACCTTCGGTCGG-GAGTTCA 359


10691R-1.IR_full       361 CGCTGGCCGTCGAGATGAAGCAGGTGGCCCAGCAGGAGGCGGAGAAGGCGCNGTTTTGTC 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
10691R-1.in silico     361 CGCTGGCCGTCGAGATGAAGCAGGTGGCCCAGCAGGAGGCGGAGAAGGCGC-GTTTTGTC 419


10691R-1.IR_full       421 GTGGAGAAGGCCGAGCAACAGAAGCTGGCGTCCATCATTTCGGCGGAGGGTGATGCCGAA 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10691R-1.in silico     421 GTGGAGAAGGCCGAGCAACAGAAGCTGGCGTCCATCATTTCGGCGGAGGGTGATGCCGAA 479


10691R-1.IR_full        481 CCGCNGNCCTGTTGGCCAAGTCA 502
                            |||| | ||||||||||||||||
10691R-1.in silico      481 CCGCTGGCCTGTTGGCCAAGTCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_057259.4  CG10691-RB, transcript variant B (l(2)37Cc), mRNA 
100   483  NM_165281.1  CG10691-RA, transcript variant A (l(2)37Cc), mRNA 
0   NM_001014696.1  CG18069-RG, transcript variant G (CaMKII), mRNA 
0   NM_166813.2  CG18069-RE, transcript variant E (CaMKII), mRNA 
0   NM_166812.2  CG18069-RD, transcript variant D (CaMKII), mRNA 
0   NM_079896.3  CG18069-RC, transcript variant C (CaMKII), mRNA 
0   NM_166810.3  CG18069-RA, transcript variant A (CaMKII), mRNA 
0   NM_166811.1  CG18069-RB, transcript variant B (CaMKII), mRNA 
0   NM_140728.2  CG7580-RA (CG7580), mRNA 
0   NM_176522.1  CG32491-RZ, transcript variant Z (mod(mdg4)), mRNA 
0   NM_079066.2  CG15110-RA (botv), mRNA 
0   NM_057464.3  CG5779-RA (Bc), mRNA 
0   NM_165878.1  CG30046-RB (CG30046), mRNA 
0   NM_170111.1  CG5410-RD, transcript variant D (Miro), mRNA 
0   NM_142948.2  CG5410-RE, transcript variant E (Miro), mRNA 
0   NM_139458.2  CG1317-RB (CG1317), mRNA 
0   NM_138020.2  CG3105-RA (CG3105), mRNA 
0   NM_168882.2  CG32435-RB, transcript variant B (chb), mRNA 
0   NM_079912.3  CG32435-RA, transcript variant A (chb), mRNA 
0   NM_168883.1  CG32435-RC, transcript variant C (chb), mRNA 
0   NM_080266.2  CG2259-RA, transcript variant A (Gclc), mRNA 
0   NM_206650.1  CG2259-RB, transcript variant B (Gclc), mRNA 
0   NM_164793.1  CG31607-RA (CG31607), mRNA 
0   NM_130606.2  CG3573-RA (CG3573), mRNA 
0   NM_139443.1  CG13809-RA (osm-1), mRNA 
0   NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 
0   NM_141832.2  CG5344-RA, transcript variant A (wkd), mRNA 
0   NM_169402.2  CG5344-RB, transcript variant B (wkd), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.