National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10628R-2 
 Symbol CG10628  Full Name CG10628 
 CG No CG10628  Old CG No CG10628 
 Synonyms CG10628 
 Accession No (Link to NCBI) NM_136155.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTAGCGGTTCGTGGAGGACA 
 Primer Seq. 3'
aatctagaggtaccTCTGGGGTCGGATGGTGGTAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCTAGCGGTT CGTGGAGGAC ATGGTGGAAA TGGACTGCCC AAATACGGAG GAGTTGGTGG 
0061 CCAAGGCGGT TGCGTCTACT TGGTGGCAAA GGAAGGACTC ACCCTTCGCA AGGTCGTCCA 
0121 GGGATTGAAG GATAAGCGAG TGGCAGCATC CAGTGGCGAG GACAGTAGCA AAGCCAGCAT 
0181 CTTTGGACGC CGTGGAGCTG ACCAGAGGAT CGAGGTGCCT GTGGGCGTCC AGGTATATGA 
0241 CGACCAACAA AAACTCATCG CCGACCTCGA CGAGGCACGA GGCGACATGC ATTGTGGCGG 
0301 GCGGAGGTAC TGGCGGATGC ACGGCCACAA ATTTTCTGGG ACGTCCCGGG GAGAATCGCA 
0361 CTGTAAATCT GGACCTAAAG CTAATAGCAG ATGTGGGTCT CGTGGGATTC CCCAACGCTG 
0421 GCAAAAGCAC CCTTCTTAAG GCCGTGTCCA ATGCCAAACC AAAAATTGCA GCTTATCCCT 
0481 TTACCACCAT CCGACCCCAG A 
 in silico PCR Fragment
0001 CCTAGCGGTT CGTGGAGGAC ATGGTGGAAA TGGACTGCCC AAATACGGAG GAGTTGGTGG 
0061 CCAAGGCGGT TGCGTCTACT TGGTGGCAAA GGAAGGACTC ACCCTTCGCA AGGTCGTCCA 
0121 GGGATTGAAG GATAAGCGAG TGGCAGCATC CAGTGGCGAG GACAGTAGCA AAGCCAGCAT 
0181 CTTTGGACGC CGTGGAGCTG ACCAGAGGAT CGAGGTGCCT GTGGGCGTCC AGGTATATGA 
0241 CGACCAACAA AAACTCATCG CCGACCTCGA CGA-GCACGA GGCGACATGC ATTGTGGCGG 
0301 GCGGAGGTAC TGGCGGATGC ACGGCCACAA ATTTTCTGGG ACGTCCCGGG GAGAATCGCA 
0361 CTGTAAATCT GGACCTAAAG CTAATAGCAG ATGTGGGTCT CGTGGGATTC CCCAACGCTG 
0421 GCAAAAGCAC CCTTCTTAAG GCCGTGTCCA ATGCCAAACC AAAAATTGCA GCTTATCCCT 
0481 TTACCACCAT CCGACCCCAG A 
 Assemble Data

10628R-2.IR_full       1   CCTAGCGGTTCGTGGAGGACATGGTGGAAATGGACTGCCCAAATACGGAGGAGTTGGTGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10628R-2.in silico     1   CCTAGCGGTTCGTGGAGGACATGGTGGAAATGGACTGCCCAAATACGGAGGAGTTGGTGG 60


10628R-2.IR_full       61  CCAAGGCGGTTGCGTCTACTTGGTGGCAAAGGAAGGACTCACCCTTCGCAAGGTCGTCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10628R-2.in silico     61  CCAAGGCGGTTGCGTCTACTTGGTGGCAAAGGAAGGACTCACCCTTCGCAAGGTCGTCCA 120


10628R-2.IR_full       121 GGGATTGAAGGATAAGCGAGTGGCAGCATCCAGTGGCGAGGACAGTAGCAAAGCCAGCAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10628R-2.in silico     121 GGGATTGAAGGATAAGCGAGTGGCAGCATCCAGTGGCGAGGACAGTAGCAAAGCCAGCAT 180


10628R-2.IR_full       181 CTTTGGACGCCGTGGAGCTGACCAGAGGATCGAGGTGCCTGTGGGCGTCCAGGTATATGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10628R-2.in silico     181 CTTTGGACGCCGTGGAGCTGACCAGAGGATCGAGGTGCCTGTGGGCGTCCAGGTATATGA 240


10628R-2.IR_full       241 CGACCAACAAAAACTCATCGCCGACCTCGACGAGGCACGAGGCGACATGCATTGTGGCGG 300
                           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
10628R-2.in silico     241 CGACCAACAAAAACTCATCGCCGACCTCGACGA-GCACGAGGCGACATGCATTGTGGCGG 300


10628R-2.IR_full       301 GCGGAGGTACTGGCGGATGCACGGCCACAAATTTTCTGGGACGTCCCGGGGAGAATCGCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10628R-2.in silico     301 GCGGAGGTACTGGCGGATGCACGGCCACAAATTTTCTGGGACGTCCCGGGGAGAATCGCA 360


10628R-2.IR_full       361 CTGTAAATCTGGACCTAAAGCTAATAGCAGATGTGGGTCTCGTGGGATTCCCCAACGCTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10628R-2.in silico     361 CTGTAAATCTGGACCTAAAGCTAATAGCAGATGTGGGTCTCGTGGGATTCCCCAACGCTG 420


10628R-2.IR_full       421 GCAAAAGCACCCTTCTTAAGGCCGTGTCCAATGCCAAACCAAAAATTGCAGCTTATCCCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10628R-2.in silico     421 GCAAAAGCACCCTTCTTAAGGCCGTGTCCAATGCCAAACCAAAAATTGCAGCTTATCCCT 480


10628R-2.IR_full       481 TTACCACCATCCGACCCCAGA 501
                           |||||||||||||||||||||
10628R-2.in silico     481 TTACCACCATCCGACCCCAGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136155.2  CG10628-RA (CG10628), mRNA 
0   NM_135374.2  CG13390-RA (CG13390), mRNA 
0   NM_176692.1  CG3960-RD, transcript variant D (CG3960), mRNA 
0   NM_206636.1  CG3960-RF, transcript variant F (CG3960), mRNA 
0   NM_136911.2  CG8850-RA, transcript variant A (CG8850), mRNA 
0   NM_165871.1  CG8850-RB, transcript variant B (CG8850), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_139554.3  CG12076-RA, transcript variant A (YT521-B), mRNA 
0   NM_168029.1  CG12076-RB, transcript variant B (YT521-B), mRNA 
0   NM_130606.2  CG3573-RA (CG3573), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   NM_168671.2  CG32158-RA, transcript variant A (CG32158), mRNA 
0   NM_206386.1  CG32158-RF, transcript variant F (CG32158), mRNA 
0   NM_167416.1  CG32593-RE, transcript variant E (Flo-2), mRNA 
0   NM_167417.1  CG32593-RF, transcript variant F (Flo-2), mRNA 
0   NM_167419.1  CG32593-RC, transcript variant C (Flo-2), mRNA 
0   NM_167421.1  CG32593-RD, transcript variant D (Flo-2), mRNA 
0   NM_078602.2  CG32593-RB, transcript variant B (Flo-2), mRNA 
0   NM_167415.1  CG32593-RA, transcript variant A (Flo-2), mRNA 
0   NM_078992.2  CG8581-RA, transcript variant A (fra), mRNA 
0   NM_165913.1  CG8581-RB, transcript variant B (fra), mRNA 
0   NM_001014537.1  CG15112-RD, transcript variant D (ena), mRNA 
0   NM_166331.1  CG15112-RB, transcript variant B (ena), mRNA 
0   NM_139462.1  CG13800-RA (CG13800), mRNA 
0   NM_166329.1  CG15112-RA, transcript variant A (ena), mRNA 
0   NM_001014536.1  CG15112-RE, transcript variant E (ena), mRNA 
0   NM_166330.1  CG15112-RC, transcript variant C (ena), mRNA 
0   NM_169202.1  CG11094-RA, transcript variant A (dsx), mRNA 
0   NM_057468.2  CG2005-RB, transcript variant B (Ptp99A), mRNA 
0   NM_001014683.1  CG2005-RD, transcript variant D (Ptp99A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.