National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10619R-3 
 Symbol tup  Full Name tailup 
 CG No CG10619  Old CG No CG10619 
 Synonyms CG10619, isl, islet, Isl, l(2)E41, l(2)37Aa, tup 
 Accession No (Link to NCBI) NM_057427.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTAATGGCAGAGATTGGTGG 
 Primer Seq. 3'
aatctagaggtaccTTGCAGTACAAAGCCCCGGCA 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 GGTAATGGCA GAGATTGGTG GCCATTTgGN TCACCAGCTA CCGTTGCACA ATCACAACCA 
0061 CAATCAAACT GGATTACAGC CATCGCTGGT GATGAACCAT CACCTGGATT TGGATTGCCA 
0121 TGGACACGAT GTGATAAAAA AACAACGCCT ATCTCACTGC GTCGGCTGTG GCGGCCAGAT 
0181 CCACGATCAG TACATCTTGC GCGTTGCCCC CGATCTGGAG TGGCATGCGG CGTGTCTGAA 
0241 GTGCCAGGAG TGCAGGCAGT TCCTGGACGA AAGCTGTACG TGTTTTGTGC GCGATGGCAA 
0301 GACCTACTGC AAGCGTGATT ATGTTAGGTT ATTTGGTACA AAATGTGATA AATGCGGCAA 
0361 CTCCTTCAGC AAAAATGATT TTGTGATGCG GGCCAAAACG AAAATCTTTC ACATCGAGTG 
0421 CTTTCGATGC TCCGCGTGTG CGCGACAATT GCTGCCAGGC GATGAATTCG CGTTACgCGA 
0481 TGCCGGGGCT TTGTACTGCA A 
 in silico PCR Fragment
0001 GGTAATGGCA GAGATTGGTG GCCATTTGGC TCACCAGCTA CCGTTGCACA ATCACAACCA 
0061 CAATCAAACT GGATTACAGC CATCGCTGGT GATGAACCAT CACCTGGATT TGGATTGCCA 
0121 TGGACACGAT GTGATAAAAA AACAACGCCT ATCTCACTGC GTCGGATGTG GCGGCCAGAT 
0181 CCACGATCAG TACATCTTGC GCGTTGCCCC CGATCTGGAG TGGCATGCGG CGTGTCTGAA 
0241 GTGCCAGGAG TGCAGGCAGT TCCTGGACGA AAGCTGTACG TGTTTTGTGC GCGATGGCAA 
0301 GACCTACTGC AAGCGTGATT ATGTTAGGTT ATTTGGTACA AAATGTGATA AATGCGGCAA 
0361 CTCCTTCAGC AAAAATGATT TTGTGATGCG GGCCAAAACG AAAATCTTTC ACATCGAGTG 
0421 CTTTCGATGC TCCGCGTGTG CGCGACAATT GCTGCCAGGC GATGAATTCG CGTTACGCGA 
0481 TGCCGGGGCT TTGTACTGCA A 
 Assemble Data

10619R-3.IR_full       1   GGTAATGGCAGAGATTGGTGGCCATTTGGNTCACCAGCTACCGTTGCACAATCACAACCA 60
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
10619R-3.in silico     1   GGTAATGGCAGAGATTGGTGGCCATTTGGCTCACCAGCTACCGTTGCACAATCACAACCA 60


10619R-3.IR_full       61  CAATCAAACTGGATTACAGCCATCGCTGGTGATGAACCATCACCTGGATTTGGATTGCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10619R-3.in silico     61  CAATCAAACTGGATTACAGCCATCGCTGGTGATGAACCATCACCTGGATTTGGATTGCCA 120


10619R-3.IR_full       121 TGGACACGATGTGATAAAAAAACAACGCCTATCTCACTGCGTCGGCTGTGGCGGCCAGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
10619R-3.in silico     121 TGGACACGATGTGATAAAAAAACAACGCCTATCTCACTGCGTCGGATGTGGCGGCCAGAT 180


10619R-3.IR_full       181 CCACGATCAGTACATCTTGCGCGTTGCCCCCGATCTGGAGTGGCATGCGGCGTGTCTGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10619R-3.in silico     181 CCACGATCAGTACATCTTGCGCGTTGCCCCCGATCTGGAGTGGCATGCGGCGTGTCTGAA 240


10619R-3.IR_full       241 GTGCCAGGAGTGCAGGCAGTTCCTGGACGAAAGCTGTACGTGTTTTGTGCGCGATGGCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10619R-3.in silico     241 GTGCCAGGAGTGCAGGCAGTTCCTGGACGAAAGCTGTACGTGTTTTGTGCGCGATGGCAA 300


10619R-3.IR_full       301 GACCTACTGCAAGCGTGATTATGTTAGGTTATTTGGTACAAAATGTGATAAATGCGGCAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10619R-3.in silico     301 GACCTACTGCAAGCGTGATTATGTTAGGTTATTTGGTACAAAATGTGATAAATGCGGCAA 360


10619R-3.IR_full       361 CTCCTTCAGCAAAAATGATTTTGTGATGCGGGCCAAAACGAAAATCTTTCACATCGAGTG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10619R-3.in silico     361 CTCCTTCAGCAAAAATGATTTTGTGATGCGGGCCAAAACGAAAATCTTTCACATCGAGTG 420


10619R-3.IR_full       421 CTTTCGATGCTCCGCGTGTGCGCGACAATTGCTGCCAGGCGATGAATTCGCGTTACGCGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10619R-3.in silico     421 CTTTCGATGCTCCGCGTGTGCGCGACAATTGCTGCCAGGCGATGAATTCGCGTTACGCGA 480


10619R-3.IR_full       481 TGCCGGGGCTTTGTACTGCAA 501
                           |||||||||||||||||||||
10619R-3.in silico     481 TGCCGGGGCTTTGTACTGCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_057426.3  CG10619-RB, transcript variant B (tup), mRNA 
100   483  NM_057427.2  CG10619-RA, transcript variant A (tup), mRNA 
0.2   NM_138124.2  CG3589-RA (CG3589), mRNA 
0   NM_137294.1  CG8317-RA (CG8317), mRNA 
0   NM_168539.1  CG32119-RA (CG32119), mRNA 
0   NM_165569.1  CG1877-RA, transcript variant A (lin19), mRNA 
0   NM_165570.1  CG1877-RB, transcript variant B (lin19), mRNA 
0   NM_165571.1  CG1877-RC, transcript variant C (lin19), mRNA 
0   NM_078931.2  CG1877-RD, transcript variant D (lin19), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_141586.1  CG9731-RA (CG9731), mRNA 
0   NM_164598.1  CG2950-RA, transcript variant A (CG2950), mRNA 
0   NM_135022.1  CG2950-RB, transcript variant B (CG2950), mRNA 
0   NM_164599.1  CG2950-RC, transcript variant C (CG2950), mRNA 
0   19  66  NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_136045.2  CG10414-RA (CG10414), mRNA 
0   11  NM_079167.3  CG12002-RA, transcript variant A (Pxn), mRNA 
0   11  NM_206255.1  CG12002-RC, transcript variant C (Pxn), mRNA 
0   11  NM_206253.1  CG12002-RE, transcript variant E (Pxn), mRNA 
0   11  NM_206254.1  CG12002-RD, transcript variant D (Pxn), mRNA 
0   NM_132443.1  CG16922-RA (CG16922), mRNA 
0   12  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_078721.1  CG2914-RA (Ets21C), mRNA 
0   NM_132046.2  CG3016-RA (CG3016), mRNA 
0   NM_001032402.1  CG33957-RB, transcript variant B (cp309), mRNA 
0   NM_169144.1  CG10272-RC, transcript variant C (gpp), mRNA 
0   NM_169143.1  CG10272-RD, transcript variant D (gpp), mRNA 
0   NM_141398.1  CG10272-RA, transcript variant A (gpp), mRNA 
0   NM_169142.1  CG10272-RB, transcript variant B (gpp), mRNA 
0   13  NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.