National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10611R-3 
 Symbol fbp  Full Name fructose-1,6-bisphosphatase 
 CG No CG31692  Old CG No CG10611 
 Synonyms FbPase, CG10611, CG31692, fbp 
 Accession No (Link to NCBI) NM_136157.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACCCAACAGAGGCCAGCT 
 Primer Seq. 3'
aatctagaggtaccCCACCAGCTGATTTCCGGGCT 
 Predicted Fragment Size
490 
 IR fragment full Seq
0001 ATGACCCAAC AGAGGCCAGC TTTCGACTCC AATGCGATGA CGCTGACGCG TTTCGTGCTG 
0061 CAGGAGCAGC GAAAGTTCAA GAGCGCCACT GGCGATCTCT CCCAGCTGCT CAACTCCATC 
0121 CAGACCGCCA TCAAGGCTAC ATCATCCGCG GTGCGGAAGG CAGGTATCGC CAAGCTCCAT 
0181 GGATTCGCTG GCGACGTGAA TGTCCAAGGC GAGGAGGTCA AGAAACTGGA CGTGCTCTCC 
0241 AACGAGCTGT TCATCAACAT GCTGAAGTCA TCCTATACCA CATGTCTAAT GGTTTCCGAG 
0301 GAGAACGAGA ATGTGATCGA GGTGGAAGTG GAGAAACAGG GCAAATACAT CGTGTGCTTC 
0361 GATCCCCTGG ATGGATCCTC CAACATAGAC TGCCTGGTGT CGATCGGTTC AATCTTCGCC 
0421 ATTTACCGCA AGAAAAGCGA TGGTCCGCCC ACAGTGGAGG ATgCACTGCA GCCCGGAAAT 
0481 CAGCTGGTGG  
 in silico PCR Fragment
0001 ATGACCCAAC AGAGGCCAGC TTTCGACTCC AATGCGATGA CGCTGACGCG TTTCGTGCTG 
0061 CAGGAGCAGC GAAAGTTCAA GAGCGCCACT GGCGATCTCT CCCAGCTGCT CAACTCCATC 
0121 CAGACCGCCA TCAAGGCTAC ATCATCCGCG GTGCGGAAGG CAGGTATCGC CAAGCTCCAT 
0181 GGATTCGCTG GCGACGTGAA TGTCCAAGGC GAGGAGGTCA AGAAACTGGA CGTGCTCTCC 
0241 AACGAGCTGT TCATCAACAT GCTGAAGTCA TCCTATACCA CATGTCTAAT GGTTTCCGAG 
0301 GAGAACGAGA ATGTGATCGA GGTGGAAGTG GAGAAACAGG GCAAATACAT CGTGTGCTTC 
0361 GATCCCTTGG ATGGATCCTC CAACATAGAC TGCCTGGTGT CGATCGGTTC AATCTTCGCC 
0421 ATTTACCGCA AGAAAAGCGA TGGTCCGCCC ACAGTGGAGG ATGCACTGCA GCCCGGAAAT 
0481 CAGCTGGTGG  
 Assemble Data

10611R-3.IR_full       1   ATGACCCAACAGAGGCCAGCTTTCGACTCCAATGCGATGACGCTGACGCGTTTCGTGCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     1   ATGACCCAACAGAGGCCAGCTTTCGACTCCAATGCGATGACGCTGACGCGTTTCGTGCTG 60


10611R-3.IR_full       61  CAGGAGCAGCGAAAGTTCAAGAGCGCCACTGGCGATCTCTCCCAGCTGCTCAACTCCATC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     61  CAGGAGCAGCGAAAGTTCAAGAGCGCCACTGGCGATCTCTCCCAGCTGCTCAACTCCATC 120


10611R-3.IR_full       121 CAGACCGCCATCAAGGCTACATCATCCGCGGTGCGGAAGGCAGGTATCGCCAAGCTCCAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     121 CAGACCGCCATCAAGGCTACATCATCCGCGGTGCGGAAGGCAGGTATCGCCAAGCTCCAT 180


10611R-3.IR_full       181 GGATTCGCTGGCGACGTGAATGTCCAAGGCGAGGAGGTCAAGAAACTGGACGTGCTCTCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     181 GGATTCGCTGGCGACGTGAATGTCCAAGGCGAGGAGGTCAAGAAACTGGACGTGCTCTCC 240


10611R-3.IR_full       241 AACGAGCTGTTCATCAACATGCTGAAGTCATCCTATACCACATGTCTAATGGTTTCCGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     241 AACGAGCTGTTCATCAACATGCTGAAGTCATCCTATACCACATGTCTAATGGTTTCCGAG 300


10611R-3.IR_full       301 GAGAACGAGAATGTGATCGAGGTGGAAGTGGAGAAACAGGGCAAATACATCGTGTGCTTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     301 GAGAACGAGAATGTGATCGAGGTGGAAGTGGAGAAACAGGGCAAATACATCGTGTGCTTC 360


10611R-3.IR_full       361 GATCCCCTGGATGGATCCTCCAACATAGACTGCCTGGTGTCGATCGGTTCAATCTTCGCC 420
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     361 GATCCCTTGGATGGATCCTCCAACATAGACTGCCTGGTGTCGATCGGTTCAATCTTCGCC 420


10611R-3.IR_full       421 ATTTACCGCAAGAAAAGCGATGGTCCGCCCACAGTGGAGGATGCACTGCAGCCCGGAAAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10611R-3.in silico     421 ATTTACCGCAAGAAAAGCGATGGTCCGCCCACAGTGGAGGATGCACTGCAGCCCGGAAAT 480


10611R-3.IR_full       481 CAGCTGGTGG 490
                           ||||||||||
10611R-3.in silico     481 CAGCTGGTGG 490

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_136157.2  CG3620-RB, transcript variant B (norpA), mRNA,6-bisphosphatase CG31692-RA, transcript variant A (fbp), mRNA 
100   472  NM_165314.1  CG3620-RB, transcript variant B (norpA), mRNA,6-bisphosphatase CG31692-RA, transcript variant A (fbp), mRNA,6-bisphosphatase CG31692-RB, transcript variant B (fbp), mRNA 
0.21   NM_136534.2  CG2121-RA (CG2121), mRNA 
0.21   NM_058025.3  CG4008-RA (und), mRNA 
0   NM_143142.2  CG5116-RA (CG5116), mRNA 
0   NM_079395.2  CG9695-RA (Dab), mRNA 
0   NM_078835.2  CG12283-RA (kek1), mRNA 
0   NM_142640.2  CG16953-RA (CG16953), mRNA 
0   NM_167155.1  CG32712-RA (CG32712), mRNA 
0   NM_135831.2  CG7578-RA, transcript variant A (sec71), mRNA 
0   NM_165059.1  CG7578-RB, transcript variant B (sec71), mRNA 
0   NM_167166.2  CG12108-RA (Ppt1), mRNA 
0   NM_170621.3  CG12052-RE, transcript variant E (lola), mRNA 
0   NM_170620.2  CG12052-RD, transcript variant D (lola), mRNA 
0   NM_169882.1  CG4836-RB, transcript variant B (CG4836), mRNA 
0   NM_169883.1  CG4836-RA, transcript variant A (CG4836), mRNA 
0   NM_142599.1  CG4836-RC, transcript variant C (CG4836), mRNA 
0   NM_078837.2  CG7820-RA (CAH1), mRNA 
0   NM_135832.2  CG16889-RA (adat), mRNA 
0   NM_132047.2  CG16721-RA (CG16721), mRNA 
0   NM_137828.1  CG10972-RA (ppk12), mRNA 
0   NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_164660.1  CG9171-RA, transcript variant A (CG9171), mRNA 
0   NM_135114.2  CG9171-RB, transcript variant B (CG9171), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_176399.1  CG31531-RC, transcript variant C (CG31531), mRNA 
0   NM_169014.1  CG31531-RA, transcript variant A (CG31531), mRNA 
0   NM_169015.1  CG31531-RB, transcript variant B (CG31531), mRNA 
0   NM_176737.1  CG9213-RA (CG9213), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.