National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10603R-4 
 Symbol mRpL13  Full Name mitochondrial ribosomal protein L13 
 CG No CG10603  Old CG No CG10603 
 Synonyms CG10603, L13, anon-EST:fe3C4, mRpL13 
 Accession No (Link to NCBI) NM_078874.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCCATTGCGAAGCGTGTG 
 Primer Seq. 3'
aatctagaggtaccTTGGGGAAGTTCTCCAGCGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTCCATTG CGAAGCGTGT GCAGCAATGG GCAACGTTCG CGCGCACTTG GCACATTTAC 
0061 GATTGCACCT GGCAGAATCC ATTCGAGTCG GCAAAACTGG TTAAAACGCA TTTATTGGGC 
0121 CTCCAAAAGC CCATTTACCA CCCAATGAAT GACTGCGGGG ATCATGTGGT GCTGATCAAC 
0181 ACGCGGGAAA TCGCTTTGCC CGGTGACGAG TGGGTGAAGA GGGTTTACTT CCACCACACC 
0241 GGCTATCCTG GTGGCGCTTC GTGGACCCTG GCGTGGCAGC TGCACGAGAA GGATCCCACG 
0301 ATGGTGATGA AGAAGGCCGT GTACAACTCG ATGCGCGGAA ATCTGCAGCG CAGGCACACC 
0361 ATGCAAAGAC TGCACTTGTT CGCCGACGAT CAGGTGCCCG AGGAAATCCT GCAAAACGTC 
0421 ACGAATCAAA TCCGCNACGC CGCGCTCTAT TCCCCAGCGT CTGGATCATA TCGACAAAGA 
0481 AACGCTGGAG AACTTCCCCA A 
 in silico PCR Fragment
0001 ATGTCCATTG CGAAGCGTGT GCAGCAATGG GCAACGTTCG CGCGCACTTG GCACATTTAC 
0061 GATTGCACCT GGCAGAATCC ATTCGAGTCG GCAAAACTGG TTAAAACGCA TTTATTGGGC 
0121 CTCCAAAAGC CCATTTACCA CCCAATGAAT GACTGCGGGG ATCATGTGGT GCTGATCAAC 
0181 ACGCGGGAAA TCGCTTTGCC CGGTGACGAG TGGGTGAAGA GGGTTTACTT CCACCACACC 
0241 GGCTATCCTG GTGGCGCTTC GTGGACCCTG GCGTGGCAGC TGCACGAGAA GGATCCCACG 
0301 ATGGTGATGA AGAAGGCCGT GTACAACTCG ATGCGCGGAA ATCTGCAGCG CAGGCACACC 
0361 ATGCAAAGAC TGCACTTGTT CGCCGACGAT CAGGTGCCCG AGGAAATCCT GCAAAACGTC 
0421 ACGAATCAAA TCCGC-ACGC CGCGCTCTAT TCCCCAGCGT CTGGATCATA TCGACAAAGA 
0481 AACGCTGGAG AACTTCCCCA A 
 Assemble Data

10603R-4.IR_full       1   ATGTCCATTGCGAAGCGTGTGCAGCAATGGGCAACGTTCGCGCGCACTTGGCACATTTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     1   ATGTCCATTGCGAAGCGTGTGCAGCAATGGGCAACGTTCGCGCGCACTTGGCACATTTAC 60


10603R-4.IR_full       61  GATTGCACCTGGCAGAATCCATTCGAGTCGGCAAAACTGGTTAAAACGCATTTATTGGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     61  GATTGCACCTGGCAGAATCCATTCGAGTCGGCAAAACTGGTTAAAACGCATTTATTGGGC 120


10603R-4.IR_full       121 CTCCAAAAGCCCATTTACCACCCAATGAATGACTGCGGGGATCATGTGGTGCTGATCAAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     121 CTCCAAAAGCCCATTTACCACCCAATGAATGACTGCGGGGATCATGTGGTGCTGATCAAC 180


10603R-4.IR_full       181 ACGCGGGAAATCGCTTTGCCCGGTGACGAGTGGGTGAAGAGGGTTTACTTCCACCACACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     181 ACGCGGGAAATCGCTTTGCCCGGTGACGAGTGGGTGAAGAGGGTTTACTTCCACCACACC 240


10603R-4.IR_full       241 GGCTATCCTGGTGGCGCTTCGTGGACCCTGGCGTGGCAGCTGCACGAGAAGGATCCCACG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     241 GGCTATCCTGGTGGCGCTTCGTGGACCCTGGCGTGGCAGCTGCACGAGAAGGATCCCACG 300


10603R-4.IR_full       301 ATGGTGATGAAGAAGGCCGTGTACAACTCGATGCGCGGAAATCTGCAGCGCAGGCACACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     301 ATGGTGATGAAGAAGGCCGTGTACAACTCGATGCGCGGAAATCTGCAGCGCAGGCACACC 360


10603R-4.IR_full       361 ATGCAAAGACTGCACTTGTTCGCCGACGATCAGGTGCCCGAGGAAATCCTGCAAAACGTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     361 ATGCAAAGACTGCACTTGTTCGCCGACGATCAGGTGCCCGAGGAAATCCTGCAAAACGTC 420


10603R-4.IR_full       421 ACGAATCAAATCCGCNACGCCGCGCTCTATTCCCCAGCGTCTGGATCATATCGACAAAGA 480
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
10603R-4.in silico     421 ACGAATCAAATCCGC-ACGCCGCGCTCTATTCCCCAGCGTCTGGATCATATCGACAAAGA 480


10603R-4.IR_full       481 AACGCTGGAGAACTTCCCCAA 501
                           |||||||||||||||||||||
10603R-4.in silico     481 AACGCTGGAGAACTTCCCCAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078874.2  CG10603-RA (mRpL13), mRNA 
26.97   130  NM_136072.3  CG10602-RA, transcript variant A (CG10602), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_136472.3  CG1399-RB, transcript variant B (CG1399), mRNA 
0   NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
0   14  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_135917.2  CG18480-RA (CG18480), mRNA 
0   NM_057962.4  CG1782-RA (Uba1), mRNA 
0   10  NM_169938.1  CG5670-RC, transcript variant C (Atpalpha), mRNA 
0   10  NM_206527.1  CG5670-RF, transcript variant F (Atpalpha), mRNA 
0   10  NM_206526.1  CG5670-RG, transcript variant G (Atpalpha), mRNA 
0   10  NM_169936.1  CG5670-RA, transcript variant A (Atpalpha), mRNA 
0   10  NM_206528.1  CG5670-RE, transcript variant E (Atpalpha), mRNA 
0   10  NM_169937.1  CG5670-RB, transcript variant B (Atpalpha), mRNA 
0   10  NM_206525.1  CG5670-RH, transcript variant H (Atpalpha), mRNA 
0   10  NM_169939.1  CG5670-RD, transcript variant D (Atpalpha), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_144472.2  CG1898-RA (HBS1), mRNA 
0   NM_142215.2  CG5205-RA (CG5205), mRNA 
0   NM_169525.1  CG18290-RB, transcript variant B (Act87E), mRNA 
0   NM_135408.2  CG9466-RA (CG9466), mRNA 
0   NM_057743.3  CG18290-RA, transcript variant A (Act87E), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.