National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10603R-3 
 Symbol mRpL13  Full Name mitochondrial ribosomal protein L13 
 CG No CG10603  Old CG No CG10603 
 Synonyms CG10603, L13, anon-EST:fe3C4, mRpL13 
 Accession No (Link to NCBI) NM_078874.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGTCCATTGCGAAGCGTGTGCAGCAATGGGCAACGTTCGCGCGCACTTGGCACATTTAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GATTGCACCTGGCAGAATCCATTCGAGTCGGCAAAACTGGTTAAAACGCATTTATTGGGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTCCAAAAGCCCATTTACCACCCAATGAATGACTGCGGGGATCATGTGGTGCTGATCAAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACGCGGGAAATCGCTTTGCCCGGTGACGAGTGGGTGAAGAGGGTTTACTTCCACCACACC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCTATCCTGGTGGCGCTTCGTGGACCCTGGCGTGGCAGCTGCACGAGAAGGATCCCACG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATGGTGATGAAGAAGGCCGTGTACAACTCGATGCGCGGAAATCTGCAGCGCAGGCACACC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATGCAAAGACTGCACTTGTTCGCCGACGATCAGGTGCCCGAGGAAATCCTGCAAAACGTC 420

                           ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     421 ACGAATCAAATCCGC-ACGCCGCGCTCTATTCCCCAGCGTCTGGATCATATCGACAAAGA 480

10603R-3.IR_full       481 AACGCTGGAGAACTTCCCCAA 501
                           ||||||||||||||||||||| silico     481 AACGCTGGAGAACTTCCCCAA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078874.2  CG10603-RA (mRpL13), mRNA 
26.97   130  NM_136072.3  CG10602-RA, transcript variant A (CG10602), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_136472.3  CG1399-RB, transcript variant B (CG1399), mRNA 
0   NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
0   14  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_135917.2  CG18480-RA (CG18480), mRNA 
0   NM_057962.4  CG1782-RA (Uba1), mRNA 
0   10  NM_169938.1  CG5670-RC, transcript variant C (Atpalpha), mRNA 
0   10  NM_206527.1  CG5670-RF, transcript variant F (Atpalpha), mRNA 
0   10  NM_206526.1  CG5670-RG, transcript variant G (Atpalpha), mRNA 
0   10  NM_169936.1  CG5670-RA, transcript variant A (Atpalpha), mRNA 
0   10  NM_206528.1  CG5670-RE, transcript variant E (Atpalpha), mRNA 
0   10  NM_169937.1  CG5670-RB, transcript variant B (Atpalpha), mRNA 
0   10  NM_206525.1  CG5670-RH, transcript variant H (Atpalpha), mRNA 
0   10  NM_169939.1  CG5670-RD, transcript variant D (Atpalpha), mRNA 
0   NM_078670.2  CG7092-RA (Dhc16F), mRNA 
0   NM_144472.2  CG1898-RA (HBS1), mRNA 
0   NM_142215.2  CG5205-RA (CG5205), mRNA 
0   NM_169525.1  CG18290-RB, transcript variant B (Act87E), mRNA 
0   NM_135408.2  CG9466-RA (CG9466), mRNA 
0   NM_057743.3  CG18290-RA, transcript variant A (Act87E), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.