National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10602R-2 
 Symbol CG10602  Full Name CG10602 
 CG No CG10602  Old CG No CG10602 
 Synonyms pepCG10602, CG10602 
 Accession No (Link to NCBI) NM_136072.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTCGATGATATTGGCCAGAA 
 Primer Seq. 3'
aatctagaggtaccAGACATACGGACCACACAACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTCGATGAT ATTGGCCAGA AGCTAACGCT GGAGTTGCCA TCTGGAACGG CTAAGGGAAG 
0061 CCTTAACGTT CGCATCGATT ACGAGACTTC AAGCAGCGCC NGTGGGTTGC AGTGGCTGAA 
0121 TCCCACCCAG ACTTTGGGCA AGGAGCATCC CTATATGTTC TCCCAATGCC AGGCAATCCA 
0181 CGCTCGCTCG GTGATTCCCT GCCAAGACAC GCCAGCTGTT AAGTTTACCT ATGATGCCAC 
0241 AGTGGAGCAT CCCAGCGAGC TCACGGCCCT GATGAGCGCC CTTATCGATA AGAAGGAACC 
0301 GGGAAAGACA CTATTCAAGC AGGAGGTGCC CATTCCCGCT TATCTGGTGG CCATTGCCAT 
0361 TGGCAAATTG GTTTCCCGCC CGCTGGGGGA GAACTCCAGT GTCTGGGCTG AGGAAGCCAT 
0421 CGTGGATGCC TGCGCCGAGG AGTTTTCCGA AACAGCTACC ATGCTAAAGA CTGCCACTGA 
0481 GTTGTGTGGT CCGTATGTCT  
 in silico PCR Fragment
0001 CGTCGATGAT ATTGGCCAGA AGCTAACGCT GGAGTTGCCA TCTGGAACGG CTAAGGGAAG 
0061 CCTTAACGTT CGCATCGATT ACGAGACTTC AAGCAGCGCC AGTGGGTTGC AGTGGCTGAA 
0121 TCCCACCCAG ACTTTGGGCA AGGAGCATCC TTATATGTTC TCCCAATGCC AGGCAATCCA 
0181 CGCTCGCTCG GTGATTCCCT GCCAAGACAC GCCAGCTGTT AAGTTTACCT ATGATGCCAC 
0241 AGTGGAGCAT CCCAGCGAGC TCACGGCCCT GATGAGCGCC CTTATCGATA AGAAGGAACC 
0301 GGGAAAGACA CTATTCAAGC AGGAGGTGCC CATTCCCGCT TATCTGGTGG CCATTGCCAT 
0361 TGGCAAATTG GTTTCCCGCC CGCTGGGGGA GAACTCCAGT GTCTGGGCTG AGGAAGCCAT 
0421 CGTGGATGCC TGCGCCGAGG AGTTTTCCGA AACAGCTACC ATGCTAAAGA CTGCCACTGA 
0481 GTTGTGTGGT CCGTATGTCT  
 Assemble Data

10602R-2.IR_full       1   CGTCGATGATATTGGCCAGAAGCTAACGCTGGAGTTGCCATCTGGAACGGCTAAGGGAAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10602R-2.in silico     1   CGTCGATGATATTGGCCAGAAGCTAACGCTGGAGTTGCCATCTGGAACGGCTAAGGGAAG 60


10602R-2.IR_full       61  CCTTAACGTTCGCATCGATTACGAGACTTCAAGCAGCGCCNGTGGGTTGCAGTGGCTGAA 120
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
10602R-2.in silico     61  CCTTAACGTTCGCATCGATTACGAGACTTCAAGCAGCGCCAGTGGGTTGCAGTGGCTGAA 120


10602R-2.IR_full       121 TCCCACCCAGACTTTGGGCAAGGAGCATCCCTATATGTTCTCCCAATGCCAGGCAATCCA 180
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
10602R-2.in silico     121 TCCCACCCAGACTTTGGGCAAGGAGCATCCTTATATGTTCTCCCAATGCCAGGCAATCCA 180


10602R-2.IR_full       181 CGCTCGCTCGGTGATTCCCTGCCAAGACACGCCAGCTGTTAAGTTTACCTATGATGCCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10602R-2.in silico     181 CGCTCGCTCGGTGATTCCCTGCCAAGACACGCCAGCTGTTAAGTTTACCTATGATGCCAC 240


10602R-2.IR_full       241 AGTGGAGCATCCCAGCGAGCTCACGGCCCTGATGAGCGCCCTTATCGATAAGAAGGAACC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10602R-2.in silico     241 AGTGGAGCATCCCAGCGAGCTCACGGCCCTGATGAGCGCCCTTATCGATAAGAAGGAACC 300


10602R-2.IR_full       301 GGGAAAGACACTATTCAAGCAGGAGGTGCCCATTCCCGCTTATCTGGTGGCCATTGCCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10602R-2.in silico     301 GGGAAAGACACTATTCAAGCAGGAGGTGCCCATTCCCGCTTATCTGGTGGCCATTGCCAT 360


10602R-2.IR_full       361 TGGCAAATTGGTTTCCCGCCCGCTGGGGGAGAACTCCAGTGTCTGGGCTGAGGAAGCCAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10602R-2.in silico     361 TGGCAAATTGGTTTCCCGCCCGCTGGGGGAGAACTCCAGTGTCTGGGCTGAGGAAGCCAT 420


10602R-2.IR_full       421 CGTGGATGCCTGCGCCGAGGAGTTTTCCGAAACAGCTACCATGCTAAAGACTGCCACTGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10602R-2.in silico     421 CGTGGATGCCTGCGCCGAGGAGTTTTCCGAAACAGCTACCATGCTAAAGACTGCCACTGA 480


10602R-2.IR_full       481 GTTGTGTGGTCCGTATGTCT 500
                           ||||||||||||||||||||
10602R-2.in silico     481 GTTGTGTGGTCCGTATGTCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136072.3  CG10602-RA, transcript variant A (CG10602), mRNA 
100   482  NM_165269.1  CG10602-RD, transcript variant D (CG10602), mRNA 
100   482  NM_165268.1  CG10602-RC, transcript variant C (CG10602), mRNA 
100   482  NM_165267.1  CG10602-RB, transcript variant B (CG10602), mRNA 
0   NM_135209.1  CG11320-RA (CG11320), mRNA 
0   NM_057693.3  CG4799-RA (Pen), mRNA 
0   NM_135382.1  CG13386-RA (CG13386), mRNA 
0   NM_134829.2  CG4272-RA, transcript variant A (CG4272), mRNA 
0   NM_164480.1  CG4272-RB, transcript variant B (CG4272), mRNA 
0   NM_137865.1  CG13518-RA (Obp58b), mRNA 
0   NM_057454.3  CG16720-RA, transcript variant A (5-HT1A), mRNA 
0   NM_166322.1  CG16720-RB, transcript variant B (5-HT1A), mRNA 
0   NM_165887.1  CG30047-RA (CG30047), mRNA 
0   NM_142050.2  CG9347-RA (ninaB), mRNA 
0   NM_057942.3  CG5227-RC, transcript variant C (sdk), mRNA 
0   NM_134315.2  CG5227-RD, transcript variant D (sdk), mRNA 
0   NM_134314.2  CG5227-RB, transcript variant B (sdk), mRNA 
0   NM_057941.3  CG5227-RA, transcript variant A (sdk), mRNA 
0   NM_142366.1  CG5863-RA (CG5863), mRNA 
0   NM_078645.2  CG4252-RA (mei-41), mRNA 
0   16  NM_132034.1  CG3108-RA (CG3108), mRNA 
0   NM_167233.1  CG32687-RA (CG32687), mRNA 
0   NM_139823.1  CG14825-RA (BBS1), mRNA 
0   NM_078612.2  CG8470-RA (mRpS30), mRNA 
0   NM_176156.1  CG30044-RA (CG30044), mRNA 
0   NM_169499.1  CG8449-RA (CG8449), mRNA 
0   NM_165538.1  CG1600-RA, transcript variant A (CG1600), mRNA 
0   NM_165539.1  CG1600-RB, transcript variant B (CG1600), mRNA 
0   NM_136449.2  CG1600-RC, transcript variant C (CG1600), mRNA 
0   NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.