National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10600R-3 
 Symbol CG10600  Full Name CG10600 
 CG No CG10600  Old CG No CG10600 
 Synonyms CG10600 
 Accession No (Link to NCBI) NM_136069.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAACACTCGAGGTGGCGAAAA 
 Primer Seq. 3'
aatctagaggtaccTCTCGTCCGTACTTGTGCTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NAACACTCGA GGTGGCGAAA ATAATGTAGA ATTGGCCAAC GGCGGCAAGG AATCCACGGG 
0061 AAATGTACGA AAACCGGAGA AGAAGCCACT GGAAGGAGCG GTCGGGGCTT CCAAGCAGCG 
0121 GGAGACGCCT GAAAAGGGCG TAAACAAAGC GTCGGCAGTG GAAAACAACA ACGCAAATGC 
0181 CCGCGGAAAT GCCAGTCCAA CAACTACAAG CGCACAGCGA GNAAGCAACA ACAACAATTA 
0241 CGCCAGTGGN AACCAACAGC AGCAGCAACA ACTACAAACG GCAACACTTT ACCCACACAA 
0301 CAGCAACAAC AACTGCAGTC AGGCGATGGC AACGCAAATA ACCCAACAAC AAATGCACGT 
0361 ATAATGCTAG CTGCAGCTGA AGAGGAACAG GCAGTAGCAT CGTCGGTGGC AACAACTGCA 
0421 GGGGCACCCA CAGCCGCAAC AACAACTGCA ACAACAACCG CGTTGGCAGA CACAACAAAA 
0481 ACAAGCACAA GTACGGACGA GA 
 in silico PCR Fragment
0001 GAACACTCGA GGTGGCGAAA ATAATGTAGA ATTGGCCAAC GGCGGCAAGG AATCCACGGG 
0061 AAATGTACGA AAACCGGAGA AGAAGCCACT GGAAGGAGCG GTCGGGGCTT CCAAGCAGCG 
0121 GGAGACGCCT GAAAAGGGCG TAAACAAAGC GTCGGCAGTG GAAAACAACA ACGCAAATGC 
0181 CCGCGGAAAT GCCAGTCCAA CAACTACAAG CGCACAGCGA G-AAGCAACA ACAACAATTA 
0241 CGCCAGTGG- AACCAACAGC AGCAGCAACA ACTACAAACG GCAACACTTT ACCCACACAA 
0301 CAGCAACAAC AACTGCAGTC AGGCGATGGC AACGCAAATA ACCCAACAAC AAATGCACGT 
0361 ATAATGCTAG CTGCAGCTGA AGAGGAACAG GCAGTAGCAT CGTCGGTGGC AACAACTGCA 
0421 GGGGCACCCA CAGCCGCAAC AACAACTGCA ACAACAACCG CGTTGGCAGA CACAACAAAA 
0481 ACAAGCACAA GTACGGACGA GA 
 Assemble Data

10600R-3.IR_full        1   AACACTCGAGGTGGCGAAAATAATGTAGAATTGGCCAACGGCGGCAAGGAATCCACGGG 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10600R-3.in silico      1   AACACTCGAGGTGGCGAAAATAATGTAGAATTGGCCAACGGCGGCAAGGAATCCACGGG 59


10600R-3.IR_full       61  AAATGTACGAAAACCGGAGAAGAAGCCACTGGAAGGAGCGGTCGGGGCTTCCAAGCAGCG 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10600R-3.in silico     61  AAATGTACGAAAACCGGAGAAGAAGCCACTGGAAGGAGCGGTCGGGGCTTCCAAGCAGCG 119


10600R-3.IR_full       121 GGAGACGCCTGAAAAGGGCGTAAACAAAGCGTCGGCAGTGGAAAACAACAACGCAAATGC 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10600R-3.in silico     121 GGAGACGCCTGAAAAGGGCGTAAACAAAGCGTCGGCAGTGGAAAACAACAACGCAAATGC 179


10600R-3.IR_full       181 CCGCGGAAATGCCAGTCCAACAACTACAAGCGCACAGCGAGNAAGCAACAACAACAATTA 239
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
10600R-3.in silico     181 CCGCGGAAATGCCAGTCCAACAACTACAAGCGCACAGCGAG-AAGCAACAACAACAATTA 239


10600R-3.IR_full       241 CGCCAGTGGNAACCAACAGCAGCAGCAACAACTACAAACGGCAACACTTTACCCACACAA 299
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
10600R-3.in silico     241 CGCCAGTGG-AACCAACAGCAGCAGCAACAACTACAAACGGCAACACTTTACCCACACAA 299


10600R-3.IR_full       301 CAGCAACAACAACTGCAGTCAGGCGATGGCAACGCAAATAACCCAACAACAAATGCACGT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10600R-3.in silico     301 CAGCAACAACAACTGCAGTCAGGCGATGGCAACGCAAATAACCCAACAACAAATGCACGT 359


10600R-3.IR_full       361 ATAATGCTAGCTGCAGCTGAAGAGGAACAGGCAGTAGCATCGTCGGTGGCAACAACTGCA 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10600R-3.in silico     361 ATAATGCTAGCTGCAGCTGAAGAGGAACAGGCAGTAGCATCGTCGGTGGCAACAACTGCA 419


10600R-3.IR_full       421 GGGGCACCCACAGCCGCAACAACAACTGCAACAACAACCGCGTTGGCAGACACAACAAAA 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10600R-3.in silico     421 GGGGCACCCACAGCCGCAACAACAACTGCAACAACAACCGCGTTGGCAGACACAACAAAA 479


10600R-3.IR_full       481 ACAAGCACAAGTACGGACGAGA 501
                           ||||||||||||||||||||||
10600R-3.in silico     481 ACAAGCACAAGTACGGACGAGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  63  NM_136069.2  CG10600-RA (CG10600), mRNA 
0.82   13  53  188  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
0.82   13  53  188  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0.82   13  53  188  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0.82   11  25  NM_139676.1  CG13708-RA (CG13708), mRNA 
0.62   12  52  NM_166966.1  CG32498-RM, transcript variant M (dnc), mRNA 
0.62   12  52  NM_166967.1  CG32498-RA, transcript variant A (dnc), mRNA 
0.62   25  NM_057828.3  CG17903-RA (Cyt-c-p), mRNA 
0.41   37  235  741  NM_168571.2  CG32133-RA (CG32133), mRNA 
0.41   33  267  967  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.41   33  267  967  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.41   33  267  967  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.41   24  140  468  NM_135077.2  CG14023-RA (CG14023), mRNA 
0.41   18  89  296  NM_079903.2  CG15319-RB (nej), mRNA 
0.41   15  61  232  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0.41   15  61  222  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0.41   15  61  222  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0.41   14  47  206  NM_132041.2  CG15765-RA (CG15765), mRNA 
0.41   14  44  142  NM_080487.2  CG10572-RA (Cdk8), mRNA 
0.41   14  33  111  NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0.41   14  28  98  NM_170063.2  CG10868-RD, transcript variant D (orb), mRNA 
0.41   14  28  98  NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
0.41   14  23  87  NM_170065.2  CG10868-RE, transcript variant E (orb), mRNA 
0.41   14  23  87  NM_170064.1  CG10868-RC, transcript variant C (orb), mRNA 
0.41   13  55  213  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0.41   13  55  213  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0.41   12  57  174  NM_132328.1  CG17446-RA (CG17446), mRNA 
0.41   12  41  163  NM_132042.1  CG11462-RA (CG11462), mRNA 
0.41   11  28  75  NM_167552.1  CG4928-RA, transcript variant A (CG4928), mRNA 
0.41   11  26  116  NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.