National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10588R-2 
 Symbol CG10588  Full Name CG10588 
 CG No CG10588  Old CG No CG10588 
 Synonyms CG10588 
 Accession No (Link to NCBI) NM_141014.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CATCGTGCGTCCAGAGAAAGTTTGAATTCCTCCACCGAGAATTTTAATGGGAAATTGGCG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCATGTGCAGTACTTGTTGGCGTTGGATCATTTAGTGAACCGCAACAATATCAGGGATTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCACACTTTGTGGAACACATGATATTTATGGGGTCTGAGAAATTCCCCGTAGAGAACGAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTCGATTCGTTTGTGACCAAAAGCGGCGGTTTCAGTAATGCGCATACTGAAAACGAGGAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACTTGCTTCTACTTTGAGTTGGATCAAACTCACCTGGATAGGGGTATGGATCTATTCATG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACCTAATGAAGGCTCCACTAATGCTTCCCGATGCCATGAGTCGCGAACGCTCTGCCGTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAGTCGGAGTTCGAACAGACCCATATGAGAGATGAGGTGCGGAGAGATCAGATCCTGGCG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCTTAGCCAGTGAGGGATATCCACATGGCACTTTCAGTTGGGGAAATTATAAGACCCTT 480

10588R-2.IR_full       481 AAAGAGGGCGTCGATGATAG 500
                           |||||||||||||||||||| silico     481 AAAGAGGGCGTCGATGATAG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141014.1  CG10588-RA (CG10588), mRNA 
0   NM_057981.3  CG4063-RA (ebi), mRNA 
0   NM_142335.2  CG5208-RA (CG5208), mRNA 
0   NM_001043313.1  CG34155-RA (CG34155), mRNA 
0   NM_166414.1  CG10067-RB, transcript variant B (Act57B), mRNA 
0   NM_079076.3  CG10067-RA, transcript variant A (Act57B), mRNA 
0   20  NM_136033.2  CG12750-RA (ncm), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   31  NM_132529.2  CG2025-RA (CG2025), mRNA 
0   NM_130646.2  CG14045-RA (CG14045), mRNA 
0   NM_079872.4  CG1873-RA, transcript variant A (Ef1alpha100E), mRNA 
0   NM_206592.1  CG1873-RD, transcript variant D (Ef1alpha100E), mRNA 
0   NM_206593.1  CG1873-RC, transcript variant C (Ef1alpha100E), mRNA 
0   NM_170570.1  CG1873-RB, transcript variant B (Ef1alpha100E), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_078717.2  CG3696-RA, transcript variant A (kis), mRNA 
0   NM_001043222.1  CG9610-RC (Poxm), mRNA 
0   NM_164918.1  CG5096-RA (CG5096), mRNA 
0   NM_079717.2  CG6703-RB, transcript variant B (Caki), mRNA 
0   NM_167955.1  CG1263-RB, transcript variant B (RpL8), mRNA 
0   NM_168466.2  CG6091-RB, transcript variant B (CG6091), mRNA 
0   NM_140225.3  CG6091-RA, transcript variant A (CG6091), mRNA 
0   NM_168465.2  CG6091-RC, transcript variant C (CG6091), mRNA 
0   NM_166452.1  CG9847-RB, transcript variant B (Fkbp13), mRNA 
0   NM_057625.3  CG9847-RA, transcript variant A (Fkbp13), mRNA 
0   NM_136955.2  CG8815-RA, transcript variant A (Sin3A), mRNA 
0   NM_165916.1  CG8815-RC, transcript variant C (Sin3A), mRNA 
0   NM_165915.1  CG8815-RB, transcript variant B (Sin3A), mRNA 
0   NM_165917.1  CG8815-RD, transcript variant D (Sin3A), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.