National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10587R-2 
 Symbol CG10587  Full Name CG10587 
 CG No CG10587  Old CG No CG10587 
 Synonyms SP167, CG10587 
 Accession No (Link to NCBI) NM_141016.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACTGTCTACTGACTGCCCCC 
 Primer Seq. 3'
aatctagaggtaccTCGGTGAGACCCCAACCGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACTGTCTAC TGACTGCCCC CTTAGCCAGC ATAGAAGTCC TTGCCCAGGA CCTCAACCAG 
0061 ACCATCGATG TGAACAAGTT GGCAAAGATT GTGCAACGGC CTGGATTCCA GACCCGGGTC 
0121 GTCGGTGGTG ATGTCACTAC GAATGCACAG CTCGGTGGCT ATCTAATCGC ACTGCGCTAC 
0181 GAAATGAACT TCGTTTGCGG AGGCACCCTG CTTCACGACC TTATTCGTCC TGACGGCAGC 
0241 GCATTGCTTT CTGGGACGGG TGAAGATCAG CGATTGGTTG GCCGTCGGCG GCGCCTCCAA 
0301 GCTCAATGAT AGAGGTATCC AGCGTCAAGT CAAGGAAGTT ATCAAGTCGG CCGAATTTCG 
0361 CGAGGATGAC ATGAACATGG ATGTGGCCAT ATTACGGCTA AAGAAACCCA TGAAGGGCAA 
0421 GTCTCTCGGA CAGCTGATAT TGTGCAAAAA ACAGCTAATG CCAGGCACGG AACTCCGCGT 
0481 TTCCGGTTGG GGTCTCACCG A 
 in silico PCR Fragment
0001 TACTGTCTAC TGACTGCCCC CTTAGCCAGC ATAGAAGTCC TTGCCCAGGA CCTCAACCAG 
0061 ACCATCGATG TGAACAAGTT GGCAAAGATT GTGCAACGGC CTGGATTCCA GACCCGGGTC 
0121 GTCGGTGGTG ATGTCACTAC GAATGCACAG CTCGGTGGCT ATCTAATCGC ACTGCGCTAC 
0181 GAAATGAACT TCGTTTGCGG AGGCACCCTG CTTCACGACC TTA-TCGTCC TGACGGCAGC 
0241 GCATTGCTTT CTGGGACGGG TGAAGATCAG CGATTGGTTG GCCGTCGGCG GCGCCTCCAA 
0301 GCTCAATGAT AGAGGTATCC AGCGTCAAGT CAAGGAAGTT ATCAAGTCGG CCGAATTTCG 
0361 CGAGGATGAC ATGAACATGG ATGTGGCCAT ATTACGGCTA AAGAAACCCA TGAAGGGCAA 
0421 GTCTCTCGGA CAGCTGATAT TGTGCAAAAA ACAGCTAATG CCAGGCACGG AACTCCGCGT 
0481 TTCCGGTTGG GGTCTCACCG A 
 Assemble Data

10587R-2.IR_full       1   TACTGTCTACTGACTGCCCCCTTAGCCAGCATAGAAGTCCTTGCCCAGGACCTCAACCAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10587R-2.in silico     1   TACTGTCTACTGACTGCCCCCTTAGCCAGCATAGAAGTCCTTGCCCAGGACCTCAACCAG 60


10587R-2.IR_full       61  ACCATCGATGTGAACAAGTTGGCAAAGATTGTGCAACGGCCTGGATTCCAGACCCGGGTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10587R-2.in silico     61  ACCATCGATGTGAACAAGTTGGCAAAGATTGTGCAACGGCCTGGATTCCAGACCCGGGTC 120


10587R-2.IR_full       121 GTCGGTGGTGATGTCACTACGAATGCACAGCTCGGTGGCTATCTAATCGCACTGCGCTAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10587R-2.in silico     121 GTCGGTGGTGATGTCACTACGAATGCACAGCTCGGTGGCTATCTAATCGCACTGCGCTAC 180


10587R-2.IR_full       181 GAAATGAACTTCGTTTGCGGAGGCACCCTGCTTCACGACCTTATTCGTCCTGACGGCAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
10587R-2.in silico     181 GAAATGAACTTCGTTTGCGGAGGCACCCTGCTTCACGACCTTA-TCGTCCTGACGGCAGC 240


10587R-2.IR_full       241 GCATTGCTTTCTGGGACGGGTGAAGATCAGCGATTGGTTGGCCGTCGGCGGCGCCTCCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10587R-2.in silico     241 GCATTGCTTTCTGGGACGGGTGAAGATCAGCGATTGGTTGGCCGTCGGCGGCGCCTCCAA 300


10587R-2.IR_full       301 GCTCAATGATAGAGGTATCCAGCGTCAAGTCAAGGAAGTTATCAAGTCGGCCGAATTTCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10587R-2.in silico     301 GCTCAATGATAGAGGTATCCAGCGTCAAGTCAAGGAAGTTATCAAGTCGGCCGAATTTCG 360


10587R-2.IR_full       361 CGAGGATGACATGAACATGGATGTGGCCATATTACGGCTAAAGAAACCCATGAAGGGCAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10587R-2.in silico     361 CGAGGATGACATGAACATGGATGTGGCCATATTACGGCTAAAGAAACCCATGAAGGGCAA 420


10587R-2.IR_full       421 GTCTCTCGGACAGCTGATATTGTGCAAAAAACAGCTAATGCCAGGCACGGAACTCCGCGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10587R-2.in silico     421 GTCTCTCGGACAGCTGATATTGTGCAAAAAACAGCTAATGCCAGGCACGGAACTCCGCGT 480


10587R-2.IR_full       481 TTCCGGTTGGGGTCTCACCGA 501
                           |||||||||||||||||||||
10587R-2.in silico     481 TTCCGGTTGGGGTCTCACCGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141016.1  CG10587-RA (CG10587), mRNA 
0   NM_136196.1  CG17472-RA (CG17472), mRNA 
0   NM_168734.2  CG6333-RA (CG6333), mRNA 
0   NM_165424.2  CG2682-RC, transcript variant C (d4), mRNA 
0   NM_136319.3  CG2682-RA, transcript variant A (d4), mRNA 
0   NM_166459.1  CG30289-RA (CG30289), mRNA 
0   NM_080153.3  CG10261-RA, transcript variant A (aPKC), mRNA 
0   NM_001043076.1  CG10261-RC, transcript variant C (aPKC), mRNA 
0   NM_001043080.1  CG10261-RD, transcript variant D (aPKC), mRNA 
0   NM_001038980.1  CG34024-RA (CG34024), mRNA 
0   13  12  NM_141015.1  CG11037-RA (CG11037), mRNA 
0   NR_002693.1  CR15280, mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_140247.2  CG6004-RB (CG6004), mRNA 
0   NM_136559.2  CG8738-RA (CG8738), mRNA 
0   NM_169517.1  CG8870-RA (CG8870), mRNA 
0   NM_079780.2  CG8333-RA (HLHmgamma), mRNA 
0   NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_130558.2  CG14787-RA (CG14787), mRNA 
0   NM_141752.2  CG14689-RA (CG14689), mRNA 
0   NM_001038894.1  CG33965-RA (CG33965), mRNA 
0   NM_169985.1  CG31465-RA (CG31465), mRNA 
0   NM_135878.1  CG4650-RA (CG4650), mRNA 
0   NM_136696.1  CG12133-RA (CG12133), mRNA 
0   NM_166413.2  CG10052-RA (Rx), mRNA 
0   NM_141729.1  CG12817-RA, transcript variant A (CG12817), mRNA 
0   NM_141728.2  CG12420-RA (CG12420), mRNA 
0   NM_143526.1  CG9737-RA (CG9737), mRNA 
0   NM_133020.2  CG6506-RA (CG6506), mRNA 
0   NM_143024.2  CG13630-RA (CG13630), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.