National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10587R-1 
 Symbol CG10587  Full Name CG10587 
 CG No CG10587  Old CG No CG10587 
 Synonyms SP167, CG10587 
 Accession No (Link to NCBI) NM_141016.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TACTGTCTACTGACTGCCCCCTTAGCCAGCATAGAAGTCCTTGCCCAGGACCTCAACCAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACCATCGATGTGAACAAGTTGGCAAAGATTGTGCAACGGCCTGGATTCCAGACCCGGGTC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTCGGTGGTGATGTCACTACGAATGCACAGCTCGGTGGCTATCTAATCGCACTGCGCTAC 180

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     181 GAAATGAACTTCGTTTGCGGAGGCACCCTGCTTCACGACCTTA-TCGTCCTGACGGCAGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCATTGCTTTCTGGGACGGGTGAAGATCAGCGATTGGTTGGCCGTCGGCGGCGCCTCCAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCTCAATGATAGAGGTATCCAGCGTCAAGTCAAGGAAGTTATCAAGTCGGCCGAATTTCG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGAGGATGACATGAACATGGATGTGGCCATATTACGGCTAAAGAAACCCATGAAGGGCAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTCTCTCGGACAGCTGATATTGTGCAAAAAACAGCTAATGCCAGGCACGGAACTCCGCGT 480

10587R-1.IR_full       481 TTCCGGTTGGGGTCTCACCGA 501
                           ||||||||||||||||||||| silico     481 TTCCGGTTGGGGTCTCACCGA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141016.1  CG10587-RA (CG10587), mRNA 
0   NM_136196.1  CG17472-RA (CG17472), mRNA 
0   NM_168734.2  CG6333-RA (CG6333), mRNA 
0   NM_165424.2  CG2682-RC, transcript variant C (d4), mRNA 
0   NM_136319.3  CG2682-RA, transcript variant A (d4), mRNA 
0   NM_166459.1  CG30289-RA (CG30289), mRNA 
0   NM_080153.3  CG10261-RA, transcript variant A (aPKC), mRNA 
0   NM_001043076.1  CG10261-RC, transcript variant C (aPKC), mRNA 
0   NM_001043080.1  CG10261-RD, transcript variant D (aPKC), mRNA 
0   NM_001038980.1  CG34024-RA (CG34024), mRNA 
0   13  12  NM_141015.1  CG11037-RA (CG11037), mRNA 
0   NR_002693.1  CR15280, mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_140247.2  CG6004-RB (CG6004), mRNA 
0   NM_136559.2  CG8738-RA (CG8738), mRNA 
0   NM_169517.1  CG8870-RA (CG8870), mRNA 
0   NM_079780.2  CG8333-RA (HLHmgamma), mRNA 
0   NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_130558.2  CG14787-RA (CG14787), mRNA 
0   NM_141752.2  CG14689-RA (CG14689), mRNA 
0   NM_001038894.1  CG33965-RA (CG33965), mRNA 
0   NM_169985.1  CG31465-RA (CG31465), mRNA 
0   NM_135878.1  CG4650-RA (CG4650), mRNA 
0   NM_136696.1  CG12133-RA (CG12133), mRNA 
0   NM_166413.2  CG10052-RA (Rx), mRNA 
0   NM_141729.1  CG12817-RA, transcript variant A (CG12817), mRNA 
0   NM_141728.2  CG12420-RA (CG12420), mRNA 
0   NM_143526.1  CG9737-RA (CG9737), mRNA 
0   NM_133020.2  CG6506-RA (CG6506), mRNA 
0   NM_143024.2  CG13630-RA (CG13630), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.