National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10583R-1 
 Symbol Sse  Full Name Separase 
 CG No CG10583  Old CG No CG10583 
 Synonyms sse, SSE, l(3)SG14, l(3)13m-281, CG10583, Sse 
 Accession No (Link to NCBI) NM_079211.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCCTACAGAGGGTCTAACT 
 Primer Seq. 3'
aatctagaggtaccCCCCATTGATTAAGCAGACAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATCCTACAG AGGGTCTAAC TCGCATTNCA GAGAAATGCA ATAGTCTGCC CCAAGAATGG 
0061 TGTGTCCTCC CAGCTCTGCA AGAGCTTTAA TCCCGCCACC ACCTACTCTG TTTTCAATGA 
0121 GATCATTGCC AGTGATGGAG CAATATATCT CACTCTGCTC CGACACTGTA GAAGTCCCCA 
0181 ACTGGGACCG ATTTGCCTGA AAATTTCTAA CGAAAATACG GCAAATCTCT TTCGAGAGTA 
0241 CAGCACTCTG GTGGAAAGAT TTAGGCGAGT GGTAACCGTG GATCCCCTTA ACATGAAAGG 
0301 TAAAGAGGCT AAGCAGAAGT ATTGGGAGGA GCTGAATGGT TTTGACACTT TTCTGCAAAA 
0361 ACTACTTGCC GACTTTCGGG ACATAATATC TCCATATTCC TTTCTGTTCT TTGGCAAAAG 
0421 ATATGACTGC ACTGTTGTTC AAAAACAAAT CAAAGCCACC TATACTCGTG TTGACGATTT 
0481 CTGTCTGCTT AATCAATGGG G 
 in silico PCR Fragment
0001 GATCCTACAG AGGGTCTAAC TCGCATTTCA GAGAAATGCA ATAGTCTGCC CCAAGAATGG 
0061 TGTGTCCT-C CAGCTCTGCA AGAGCTTTAA TCCCGCCACC ACCTACTCCG TTTTCAATGA 
0121 GATCATTGCC AGCGATGGAG CAATATATCT CACTCTGCTC CGACACTGTA GAAGTTCCCA 
0181 ACTGGGACCG ATTTGCCTGA AAATTTCCAA CGAAAATACG GCAAATCTCT TTCGAGAGTA 
0241 TAGCACTCTG GTGGAAAGAT TTAGGCGAGT GGTAACCGTG GATCCACTCA ACATGAAAGG 
0301 TAAAGAGGCT AAGCAGAAGT ATTGGGAGGA GCTGAATGGT TTTGACACTT TTCAGCAAAA 
0361 ACTACTTGCC GACTTTCGGG ACATAATATC TCCATATTCC TTTCTGTTCT TTGGCAAAAG 
0421 ATATGACTGC ACTGTTGTTC AAAAACAAAT CAAAGCCACC TATACTCGTG TTGACGATTT 
0481 CTGTCTGCTT AATCAATGGG G 
 Assemble Data

10583R-1.IR_full       1   GATCCTACAGAGGGTCTAACTCGCATTNCAGAGAAATGCAATAGTCTGCCCCAAGAATGG 60
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
10583R-1.in silico     1   GATCCTACAGAGGGTCTAACTCGCATTTCAGAGAAATGCAATAGTCTGCCCCAAGAATGG 60


10583R-1.IR_full       61  TGTGTCCTCCCAGCTCTGCAAGAGCTTTAATCCCGCCACCACCTACTCTGTTTTCAATGA 120
                           |||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||
10583R-1.in silico     61  TGTGTCCT-CCAGCTCTGCAAGAGCTTTAATCCCGCCACCACCTACTCCGTTTTCAATGA 120


10583R-1.IR_full       121 GATCATTGCCAGTGATGGAGCAATATATCTCACTCTGCTCCGACACTGTAGAAGTCCCCA 180
                           |||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||
10583R-1.in silico     121 GATCATTGCCAGCGATGGAGCAATATATCTCACTCTGCTCCGACACTGTAGAAGTTCCCA 180


10583R-1.IR_full       181 ACTGGGACCGATTTGCCTGAAAATTTCTAACGAAAATACGGCAAATCTCTTTCGAGAGTA 240
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
10583R-1.in silico     181 ACTGGGACCGATTTGCCTGAAAATTTCCAACGAAAATACGGCAAATCTCTTTCGAGAGTA 240


10583R-1.IR_full       241 CAGCACTCTGGTGGAAAGATTTAGGCGAGTGGTAACCGTGGATCCCCTTAACATGAAAGG 300
                            |||||||||||||||||||||||||||||||||||||||||||| || |||||||||||
10583R-1.in silico     241 TAGCACTCTGGTGGAAAGATTTAGGCGAGTGGTAACCGTGGATCCACTCAACATGAAAGG 300


10583R-1.IR_full       301 TAAAGAGGCTAAGCAGAAGTATTGGGAGGAGCTGAATGGTTTTGACACTTTTCTGCAAAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
10583R-1.in silico     301 TAAAGAGGCTAAGCAGAAGTATTGGGAGGAGCTGAATGGTTTTGACACTTTTCAGCAAAA 360


10583R-1.IR_full       361 ACTACTTGCCGACTTTCGGGACATAATATCTCCATATTCCTTTCTGTTCTTTGGCAAAAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10583R-1.in silico     361 ACTACTTGCCGACTTTCGGGACATAATATCTCCATATTCCTTTCTGTTCTTTGGCAAAAG 420


10583R-1.IR_full       421 ATATGACTGCACTGTTGTTCAAAAACAAATCAAAGCCACCTATACTCGTGTTGACGATTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10583R-1.in silico     421 ATATGACTGCACTGTTGTTCAAAAACAAATCAAAGCCACCTATACTCGTGTTGACGATTT 480


10583R-1.IR_full       481 CTGTCTGCTTAATCAATGGGG 501
                           |||||||||||||||||||||
10583R-1.in silico     481 CTGTCTGCTTAATCAATGGGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079211.2  CG10583-RA (Sse), mRNA 
0   NM_136702.2  CG18445-RA (CG18445), mRNA 
0   NM_135019.1  CG15627-RA (CG15627), mRNA 
0   NM_140983.2  CG5047-RA (CG5047), mRNA 
0   NM_136856.1  CG12444-RB, transcript variant B (Tango3), mRNA 
0   NM_165848.1  CG12444-RA, transcript variant A (Tango3), mRNA 
0   NM_143068.1  CG11786-RA (CG11786), mRNA 
0   NM_135162.1  CG13983-RA (CG13983), mRNA 
0   NM_140182.1  CG7638-RA (CG7638), mRNA 
0   NM_168226.1  CG32377-RA (CG32377), mRNA 
0   NM_170407.2  CG11958-RA, transcript variant A (Cnx99A), mRNA 
0   NM_057809.4  CG11958-RB, transcript variant B (Cnx99A), mRNA 
0   NM_001043301.1  CG11958-RC, transcript variant C (Cnx99A), mRNA 
0   NM_132996.2  CG5675-RA (X11L), mRNA 
0   NM_206133.1  CG33459-RA (CG33459), mRNA 
0   NM_132829.2  CG9281-RB, transcript variant B (CG9281), mRNA 
0   NM_167458.2  CG9281-RC, transcript variant C (CG9281), mRNA 
0   NM_001038844.1  CG31693-RB, transcript variant B (CG31693), mRNA 
0   NM_165402.2  CG31693-RA, transcript variant A (CG31693), mRNA 
0   NM_142923.2  CG10371-RB, transcript variant B (Plip), mRNA 
0   NM_170090.1  CG10371-RA, transcript variant A (Plip), mRNA 
0   NM_079947.2  CG2788-RA (Dot), mRNA 
0   NM_169947.1  CG17299-RF, transcript variant F (SNF4Agamma), mRNA 
0   NM_141697.1  CG9461-RA (CG9461), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_139660.3  CG32245-RA, transcript variant A (CG32245), mRNA 
0   NM_168095.2  CG32245-RC, transcript variant C (CG32245), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.