National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10579R-2 
 Symbol Eip63E  Full Name Ecdysone-induced protein 63E 
 CG No CG10579  Old CG No CG10579 
 Synonyms PFTAIRE, cdc2-63E, L63, CG10579, Eip63E 
 Accession No (Link to NCBI) NM_168034.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Read RD, Fenton TR, Gomez GG, Wykosky J, Vandenberg SR, Babic I, Iwanami A, Yang H, Cavenee WK, Mischel PS, Furnari FB, Thomas JB.
A kinome-wide RNAi screen in Drosophila Glia reveals that the RIO kinases mediate cell proliferation and survival through TORC2-Akt signaling in glioblastoma.
PLoS Genet. (2013) 9(2) e1003253 [ PubMed ID = 23459592 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGGCGTCACAATGCGCGAGAAAAAGGGAGGAGCCCTTCAGAAGCTCAAGAAGAGACTTTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCACAGCTTCGGCAGATTAACAATTTCCCGCGAAGATGGCGACGAGTCGACGCACCACCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCACCACCACCATCATCATCGCGGTGGACATGGCGGGCACCACAACCACGGTAACAAAGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCCATACAACGGCTACAATTCGGAGGAATACTTGGACCGACTCGAACCGAATGGCAATAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     241 ACCCGCTGACAAGACAAATTGCAGATATGGAGACTGGCGCAGCACGGACAGCACCGACCA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCACGATCGCGTCCAGAGACAGCTTTCCGTGTCCTCCGACAGCAAGTTGCTCGACGAGGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CATTCGCGAGGAGATGAAGTACCATTCGCACGTGGTCATGCGTCCCAAGAAGCCGCCCAG 420

                           |||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     421 ACCCAAATCCGAGGTCTTTCTGAACAAACAGGAAACGCATCCGCGCCGGAAACGATTCAG 480

10579R-2.IR_full       481 TGCATTTGGTGGCGACTCCC 500
                           |||||||||||||||||||| silico     481 TGCATTTGGTGGCGACTCCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  NM_168034.1  CG10579-RA, transcript variant A (Eip63E), mRNA 
100   482  16  NM_168035.1  CG10579-RB, transcript variant B (Eip63E), mRNA 
100   482  16  NM_168036.1  CG10579-RC, transcript variant C (Eip63E), mRNA 
100   482  16  NM_001043121.1  CG10579-RJ, transcript variant J (Eip63E), mRNA 
99.79   481  16  NM_001043116.1  CG10579-RF, transcript variant F (Eip63E), mRNA 
96.68   466  18  NM_001043119.1  CG10579-RI, transcript variant I (Eip63E), mRNA 
96.68   466  18  NM_001043120.1  CG10579-RG, transcript variant G (Eip63E), mRNA 
96.68   466  18  NM_001043118.1  CG10579-RK, transcript variant K (Eip63E), mRNA 
96.47   465  18  NM_079180.2  CG10579-RD, transcript variant D (Eip63E), mRNA 
96.47   465  18  NM_168033.1  CG10579-RE, transcript variant E (Eip63E), mRNA 
96.26   464  18  NM_001043117.1  CG10579-RH, transcript variant H (Eip63E), mRNA 
1.03   13  50  NM_132420.2  CG32676-RA (CG32676), mRNA 
0.41   12  24  38  NM_137883.1  CG13535-RA (CG13535), mRNA 
0.41   11  24  NM_136503.2  CG12769-RA, transcript variant A (CG12769), mRNA 
0.41   11  24  NM_165585.1  CG12769-RB, transcript variant B (CG12769), mRNA 
0.41   19  NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0.41   19  NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0.41   27  56  NM_136646.1  CG13953-RA (CG13953), mRNA 
0.41   15  51  NM_136533.1  CG11641-RA (pdm3), mRNA 
0.41   15  17  NM_140443.1  CG13482-RA (CG13482), mRNA 
0.41   13  33  NM_168560.1  CG32132-RA (CG32132), mRNA 
0.41   17  NM_143196.1  CG8968-RA (CG8968), mRNA 
0.41   17  NM_132086.1  CG15894-RA (CG15894), mRNA 
0.41   14  NM_141046.3  CG7605-RA (Rab26), mRNA 
0.41   32  NM_168240.1  CG32365-RA (CG32365), mRNA 
0.41   14  23  NM_130626.2  CG3835-RA, transcript variant A (CG3835), mRNA 
0.41   14  23  NM_166930.1  CG3835-RC, transcript variant C (CG3835), mRNA 
0.41   14  23  NM_166929.1  CG3835-RB, transcript variant B (CG3835), mRNA 
0.41   16  NM_001031952.1  CG11714-RA, transcript variant A (CG11714), mRNA 
0.41   16  NM_001031953.1  CG6128-RA, transcript variant A (CG6128), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.