National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10574R-1 
 Symbol I-2  Full Name Inhibitor-2 
 CG No CG10574  Old CG No CG10574 
 Synonyms I-2Dm, Dm I-2, CG10574, I-2, Inhibitor-2, inhibitor-2, I-2PP1 
 Accession No (Link to NCBI) NM_079289.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCCCACAGCTACCCTGCAAG 
 Primer Seq. 3'
aatctagaggtaccAAACGTCCGGAGCTGGAAGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCCCACAGC TACCCTGCAA ggGTATACTA AAGACTTCGC GTAgcNTCGA CAAGTCGGGA 
0061 GCCAGTTTTC GCAAAAGTGC CAAGTTCGAT GAGCTGAACG TGATGCAGAC CTTCCATCCG 
0121 GCCGACAAGG ACTACGGACA CATGAAAATC GATGAGCCCA AAACGCCGTA CAACTACACG 
0181 GAGGGCTTCG ACGAGAACAG GGACGAGCTG GACACGGAGT TGCTAGTGGA GAAACTCCGC 
0241 ATAGCGGCTN AACACACAGC CGTCGACAGA GAGCATCGAG GACGATGGTT CCTCCGGTGA 
0301 TGACCAGCCC CTTAGCGAAG AGGAGCGACA ACGGCGGCGC GAATTCGANG CGACNNCGTA 
0361 AGGCCCACTA TCGCGAGTTT GAGGCCGTCA AACTGGCACG AAAACTGATC CAGGAGGAGG 
0421 ACGACGACGA TGACGACGAG GACAAGGGTG CGGATAGCCG GcCCTCGGGC TCGTCACAGG 
0481 GcNCTTCCAG CTCCGGACGT TT 
 in silico PCR Fragment
0001 AGCCCACAGC TACCCTGCAA GGGTATACTA AAGACTTCGC GTAGCTTCGA CAAGTCGGGA 
0061 GCCAGTTTTC GCAAAAGTGC CAAGTTCGAT GAGCTGAACG TGATGCAGAC CTTCCATCCG 
0121 GCCGACAAGG ACTACGGACA CATGAAAATC GATGAGCCCA AAACGCCGTA CAACTACACG 
0181 GAGGGCTTCG ACGAGAACAG GGACGAGCTG GACACGGAGT TGCTAGTGGA GAAACTCCGC 
0241 ATAGCGGCT- AACACACAGC CGTCGACAGA GAGCATCGAG GACGATGGTT CCTCCGGTGA 
0301 TGACCAGCCC CTTAGCGAAG AGGAGCGACA ACGGCGGCGC GAATTCGA-G CGACGCCGTA 
0361 AGGCCCACTA TCGCGAGTTT GAGGCCGTCA AACTGGCACG AAAACTGATC CAGGAGGAGG 
0421 ACGACGACGA TGACGACGAG GACAAGGGTG CGGATAGCCG GCCCTCGGGC TCGTCACAGG 
0481 GCGCTTCCAG CTCCGGACGT TT 
 Assemble Data

10574R-1.IR_full       1   AGCCCACAGCTACCCTGCAAGGGTATACTAAAGACTTCGCGTAGCNTCGACAAGTCGGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
10574R-1.in silico     1   AGCCCACAGCTACCCTGCAAGGGTATACTAAAGACTTCGCGTAGCTTCGACAAGTCGGGA 60


10574R-1.IR_full       61  GCCAGTTTTCGCAAAAGTGCCAAGTTCGATGAGCTGAACGTGATGCAGACCTTCCATCCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10574R-1.in silico     61  GCCAGTTTTCGCAAAAGTGCCAAGTTCGATGAGCTGAACGTGATGCAGACCTTCCATCCG 120


10574R-1.IR_full       121 GCCGACAAGGACTACGGACACATGAAAATCGATGAGCCCAAAACGCCGTACAACTACACG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10574R-1.in silico     121 GCCGACAAGGACTACGGACACATGAAAATCGATGAGCCCAAAACGCCGTACAACTACACG 180


10574R-1.IR_full       181 GAGGGCTTCGACGAGAACAGGGACGAGCTGGACACGGAGTTGCTAGTGGAGAAACTCCGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10574R-1.in silico     181 GAGGGCTTCGACGAGAACAGGGACGAGCTGGACACGGAGTTGCTAGTGGAGAAACTCCGC 240


10574R-1.IR_full       241 ATAGCGGCTNAACACACAGCCGTCGACAGAGAGCATCGAGGACGATGGTTCCTCCGGTGA 300
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
10574R-1.in silico     241 ATAGCGGCT-AACACACAGCCGTCGACAGAGAGCATCGAGGACGATGGTTCCTCCGGTGA 300


10574R-1.IR_full       301 TGACCAGCCCCTTAGCGAAGAGGAGCGACAACGGCGGCGCGAATTCGANGCGACNNCGTA 360
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||
10574R-1.in silico     301 TGACCAGCCCCTTAGCGAAGAGGAGCGACAACGGCGGCGCGAATTCGA-GCGACGCCGTA 360


10574R-1.IR_full       361 AGGCCCACTATCGCGAGTTTGAGGCCGTCAAACTGGCACGAAAACTGATCCAGGAGGAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10574R-1.in silico     361 AGGCCCACTATCGCGAGTTTGAGGCCGTCAAACTGGCACGAAAACTGATCCAGGAGGAGG 420


10574R-1.IR_full       421 ACGACGACGATGACGACGAGGACAAGGGTGCGGATAGCCGGCCCTCGGGCTCGTCACAGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10574R-1.in silico     421 ACGACGACGATGACGACGAGGACAAGGGTGCGGATAGCCGGCCCTCGGGCTCGTCACAGG 480


10574R-1.IR_full       481 GCNCTTCCAGCTCCGGACGTTT 502
                           || |||||||||||||||||||
10574R-1.in silico     481 GCGCTTCCAGCTCCGGACGTTT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  21  NM_079289.2  CG10574-RA (I-2), mRNA 
1.65   27  NM_167022.1  CG32771-RA (CG32771), mRNA 
0.82   18  NM_164671.1  CG9088-RB, transcript variant B (lid), mRNA 
0.82   18  NM_078762.4  CG9088-RA, transcript variant A (lid), mRNA 
0.82   28  NM_131924.2  CG4857-RB (CG4857), mRNA 
0.82   18  NM_001043220.1  CG34127-RA (CG34127), mRNA 
0.62   19  26  82  NM_132412.1  CG9817-RA (CG9817), mRNA 
0.62   13  NM_079106.2  CG4817-RA (Ssrp), mRNA 
0.62   51  NM_176498.1  CG9297-RA, transcript variant A (CG9297), mRNA 
0.62   38  NM_176497.1  CG9297-RB, transcript variant B (CG9297), mRNA 
0.41   11  36  NM_078981.2  CG8967-RA (otk), mRNA 
0.41   22  51  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0.41   16  30  NM_132548.2  CG15736-RA (Chrac-16), mRNA 
0.41   NM_136906.1  CG13170-RA (CG13170), mRNA 
0.41   11  NM_170330.1  CG5954-RB, transcript variant B (l(3)mbt), mRNA 
0.41   11  NM_079805.2  CG5954-RA, transcript variant A (l(3)mbt), mRNA 
0.2   13  23  32  NM_079842.2  CG17958-RA (Sry-delta), mRNA 
0.2   12  23  30  NM_132095.2  CG3918-RA (CG3918), mRNA 
0.2   11  25  NM_142921.2  CG10225-RA (CG10225), mRNA 
0.2   31  NM_165735.2  CG12919-RA, transcript variant A (egr), mRNA 
0.2   31  NM_206069.1  CG12919-RB, transcript variant B (egr), mRNA 
0.2   34  NM_131944.1  CG3546-RA (CG3546), mRNA 
0.2   18  45  NM_137261.1  CG15709-RA (CG15709), mRNA 
0.2   12  32  NM_143801.2  CG5935-RB, transcript variant B (Dek), mRNA 
0.2   12  32  NM_166198.1  CG5935-RC, transcript variant C (Dek), mRNA 
0.2   12  32  NM_206139.2  CG5935-RD, transcript variant D (Dek), mRNA 
0.2   12  32  NM_166199.2  CG5935-RA, transcript variant A (Dek), mRNA 
0.2   NM_139419.1  CG13925-RA (CG13925), mRNA 
0   15  20  41  NM_141852.1  CG12594-RA (CG12594), mRNA 
0   12  12  22  NM_078601.2  CG9533-RA (rut), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.