National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10563R-3 
 Symbol l(2)37Cd  Full Name lethal (2) 37Cd 
 CG No CG10563  Old CG No CG10563 
 Synonyms l(2)37Cd, CG10563, Cd 
 Accession No (Link to NCBI) NM_136103.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCCCGATCGGATGATAGCCAC 
 Primer Seq. 3'
aatctagaggtaccGCACGCCCAGCACCTCATGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCCCGATCGG ATGATAGCCA CTCTGGGCGG CATCATCAAT GTGTCTAAGG TTTTGGGCGA 
0061 CGAAGTGAAA CGATTGGCAT TGCACTTCCA TCCGGAGAAT CCGTACAACA AACCCACTTT 
0121 TGGGGACTGC ACGGATAAGA CTGGTGTCCT GCTATCCATA ACCGTGAGGC GCCACAAAAA 
0181 GGACAAGCAA CGGCCTCCGG AATATTTTGT GCGGGTGTTG GGCCACTGCA GCAGGAGCTT 
0241 CACCTTTGAA ACGCTTTGTG ATTTCCAATA CCTACCNCTC TGGTCAACTC CCAAAAGTGA 
0301 CANACGCAAA TGCTGCCCAG GAGCTCACGT ACGCTTTGGA CCAGTTGAAA CCCAAAAACA 
0361 CCACCGACTT GGACTACTTT AAACGTCNCC ACAGCCAGNT GCTggNGCTG CCCGAATTGT 
0421 TCACCCACGT GGACACTGTC TATGCGGGCA CGTATCGCAT CGATCCCTCA GAAGACGGCC 
0481 AACATGAGGT GCTGGGCgTG C 
 in silico PCR Fragment
0001 TCCCGATCGG ATGATAGCCA CTCTGGGCGG CATCATCAAT GTGTCTAAGG TTTTGGGCGA 
0061 CGAAGTGAAA CGATTGGCGT TGCACTTCCA TCCGGAGAAT CCCTACAACA AACCCACTTT 
0121 TGGGGACTGC ACGGATAAGA CTGGTGTCCT GCTATCCATA ACCGTGAGGC GCCACAAAAA 
0181 GGACAAGCAA CGGCCTCCGG AATATTTTGT GCGGGTGTTG GGCCACTGCA GCAGGAGCTT 
0241 CACCTTTGAA ACGCTTTGTG ATTTCCAATA CCTACCCCTC TGGTCAACTC CCAAAAGTGA 
0301 CA-ACGCAAA TGCTGCCCAG GAGCTCACGT ACGCTTTGGA CCAGTTGAAA CCCAAAAACA 
0361 CCACCGACTT GGACTACTTT AAACGTCGCC ACAGCCAGTT GCTGGCGCTG CCCGAATTGT 
0421 TCACCCACGT GGACACTGTC TATGCGGGCA CGTATCGCAT CGATCCCTCA GAAGACGGCC 
0481 AACATGAGGT GCTGGGCGTG C 
 Assemble Data

10563R-3.IR_full       1   TCCCGATCGGATGATAGCCACTCTGGGCGGCATCATCAATGTGTCTAAGGTTTTGGGCGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10563R-3.in silico     1   TCCCGATCGGATGATAGCCACTCTGGGCGGCATCATCAATGTGTCTAAGGTTTTGGGCGA 60


10563R-3.IR_full       61  CGAAGTGAAACGATTGGCATTGCACTTCCATCCGGAGAATCCGTACAACAAACCCACTTT 120
                           |||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||
10563R-3.in silico     61  CGAAGTGAAACGATTGGCGTTGCACTTCCATCCGGAGAATCCCTACAACAAACCCACTTT 120


10563R-3.IR_full       121 TGGGGACTGCACGGATAAGACTGGTGTCCTGCTATCCATAACCGTGAGGCGCCACAAAAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10563R-3.in silico     121 TGGGGACTGCACGGATAAGACTGGTGTCCTGCTATCCATAACCGTGAGGCGCCACAAAAA 180


10563R-3.IR_full       181 GGACAAGCAACGGCCTCCGGAATATTTTGTGCGGGTGTTGGGCCACTGCAGCAGGAGCTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10563R-3.in silico     181 GGACAAGCAACGGCCTCCGGAATATTTTGTGCGGGTGTTGGGCCACTGCAGCAGGAGCTT 240


10563R-3.IR_full       241 CACCTTTGAAACGCTTTGTGATTTCCAATACCTACCNCTCTGGTCAACTCCCAAAAGTGA 300
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
10563R-3.in silico     241 CACCTTTGAAACGCTTTGTGATTTCCAATACCTACCCCTCTGGTCAACTCCCAAAAGTGA 300


10563R-3.IR_full       301 CANACGCAAATGCTGCCCAGGAGCTCACGTACGCTTTGGACCAGTTGAAACCCAAAAACA 360
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10563R-3.in silico     301 CA-ACGCAAATGCTGCCCAGGAGCTCACGTACGCTTTGGACCAGTTGAAACCCAAAAACA 360


10563R-3.IR_full       361 CCACCGACTTGGACTACTTTAAACGTCNCCACAGCCAGNTGCTGGNGCTGCCCGAATTGT 420
                           ||||||||||||||||||||||||||| |||||||||| |||||| ||||||||||||||
10563R-3.in silico     361 CCACCGACTTGGACTACTTTAAACGTCGCCACAGCCAGTTGCTGGCGCTGCCCGAATTGT 420


10563R-3.IR_full       421 TCACCCACGTGGACACTGTCTATGCGGGCACGTATCGCATCGATCCCTCAGAAGACGGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10563R-3.in silico     421 TCACCCACGTGGACACTGTCTATGCGGGCACGTATCGCATCGATCCCTCAGAAGACGGCC 480


10563R-3.IR_full       481 AACATGAGGTGCTGGGCGTGC 501
                           |||||||||||||||||||||
10563R-3.in silico     481 AACATGAGGTGCTGGGCGTGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136103.2  CG10563-RA (CG10563), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_137607.3  CG8654-RA (CG8654), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_143818.1  CG10240-RA (Cyp6a22), mRNA 
0   NM_130591.2  CG14814-RB, transcript variant B (CG14814), mRNA 
0   NM_166909.2  CG14814-RA, transcript variant A (CG14814), mRNA 
0   NM_169648.1  CG31392-RA (CG31392), mRNA 
0   NM_139566.1  CG10862-RA (CG10862), mRNA 
0   NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 
0   NM_057670.2  CG1429-RC, transcript variant C (Mef2), mRNA 
0   NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   NM_137337.1  CG9640-RA (CG9640), mRNA 
0   NM_001031859.1  CG33653-RB, transcript variant B (Caps), mRNA 
0   NM_001031860.1  CG33653-RA, transcript variant A (Caps), mRNA 
0   NM_206752.1  CG9163-RB, transcript variant B (mmd), mRNA 
0   NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
0   NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
0   NM_168081.1  CG32250-RA (CG32250), mRNA 
0   NM_136667.2  CG1794-RA, transcript variant A (Mmp2), mRNA 
0   NM_140806.1  CG14074-RA (CG14074), mRNA 
0   NM_133058.2  CG6123-RA (CG6123), mRNA 
0   NM_134577.1  CG1529-RA (CG1529), mRNA 
0   NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   NM_136445.2  CG1605-RA (az2), mRNA 
0   NM_079895.2  CG11064-RA (RfaBp), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.