National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10563R-2 
 Symbol l(2)37Cd  Full Name lethal (2) 37Cd 
 CG No CG10563  Old CG No CG10563 
 Synonyms l(2)37Cd, CG10563, Cd 
 Accession No (Link to NCBI) NM_136103.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCCCGATCGGATGATAGCCACTCTGGGCGGCATCATCAATGTGTCTAAGGTTTTGGGCGA 60

                           |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| silico     61  CGAAGTGAAACGATTGGCGTTGCACTTCCATCCGGAGAATCCCTACAACAAACCCACTTT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGGGACTGCACGGATAAGACTGGTGTCCTGCTATCCATAACCGTGAGGCGCCACAAAAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGACAAGCAACGGCCTCCGGAATATTTTGTGCGGGTGTTGGGCCACTGCAGCAGGAGCTT 240

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     241 CACCTTTGAAACGCTTTGTGATTTCCAATACCTACCCCTCTGGTCAACTCCCAAAAGTGA 300

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CA-ACGCAAATGCTGCCCAGGAGCTCACGTACGCTTTGGACCAGTTGAAACCCAAAAACA 360

                           ||||||||||||||||||||||||||| |||||||||| |||||| |||||||||||||| silico     361 CCACCGACTTGGACTACTTTAAACGTCGCCACAGCCAGTTGCTGGCGCTGCCCGAATTGT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCACCCACGTGGACACTGTCTATGCGGGCACGTATCGCATCGATCCCTCAGAAGACGGCC 480

10563R-2.IR_full       481 AACATGAGGTGCTGGGCGTGC 501
                           ||||||||||||||||||||| silico     481 AACATGAGGTGCTGGGCGTGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136103.2  CG10563-RA (CG10563), mRNA 
0   NM_176104.1  CG33087-RC (CG33087), mRNA 
0   NM_137607.3  CG8654-RA (CG8654), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_143818.1  CG10240-RA (Cyp6a22), mRNA 
0   NM_130591.2  CG14814-RB, transcript variant B (CG14814), mRNA 
0   NM_166909.2  CG14814-RA, transcript variant A (CG14814), mRNA 
0   NM_169648.1  CG31392-RA (CG31392), mRNA 
0   NM_139566.1  CG10862-RA (CG10862), mRNA 
0   NM_057671.2  CG1429-RB, transcript variant B (Mef2), mRNA 
0   NM_057673.2  CG1429-RA, transcript variant A (Mef2), mRNA 
0   NM_057672.2  CG1429-RD, transcript variant D (Mef2), mRNA 
0   NM_057670.2  CG1429-RC, transcript variant C (Mef2), mRNA 
0   NM_206067.1  CG1429-RF, transcript variant F (Mef2), mRNA 
0   NM_137337.1  CG9640-RA (CG9640), mRNA 
0   NM_001031859.1  CG33653-RB, transcript variant B (Caps), mRNA 
0   NM_001031860.1  CG33653-RA, transcript variant A (Caps), mRNA 
0   NM_206752.1  CG9163-RB, transcript variant B (mmd), mRNA 
0   NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
0   NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
0   NM_168081.1  CG32250-RA (CG32250), mRNA 
0   NM_136667.2  CG1794-RA, transcript variant A (Mmp2), mRNA 
0   NM_140806.1  CG14074-RA (CG14074), mRNA 
0   NM_133058.2  CG6123-RA (CG6123), mRNA 
0   NM_134577.1  CG1529-RA (CG1529), mRNA 
0   NM_080314.2  CG8590-RA (Klp3A), mRNA 
0   NM_136445.2  CG1605-RA (az2), mRNA 
0   NM_079895.2  CG11064-RA (RfaBp), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.