National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10501R-1 
 Symbol amd  Full Name alpha methyl dopa-resistant 
 CG No CG10501  Old CG No CG10501 
 Synonyms CG10501, X04695, l(2)amd alpha-methyldopa hypersensitive, l(2)amd, fAMD, l(2)amd[H], l(2)37Bk, CG17345, amd 
 Accession No (Link to NCBI) NM_057244.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGATGCCAAGGAGTTTCGGG 
 Primer Seq. 3'
aatctagaggtaccGTAGTTGGCCACAGCTTGTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGATGCCAA GGAGTTTCGG GAATTCGGCA AGGCCGCCAT TGACTACATA GCCGACTATC 
0061 TGGAGAATAT TCGGGATGAC GACGTACTGC CCAATGTGGA GCCAGGCTAT CTGTTGGACC 
0121 TGCTGCCCAC AGAGATGCCG GAAGAGCCCG AAGCGTGGAA GGATGTCCTC GGCGACATTA 
0181 GTCGCGTCAT CAAGCCGGGA CTGACCCACT GGCAGTCGCC TCACATGCAT GCCTACTACC 
0241 CCACCAGCAC CTCGTATCCC TCCATTGTGG GCGAGATGCT GGCCAGCGGG TTCGGCGTCA 
0301 TCGGATTCAG CTGGATCTGC AGTCCCGCCT GCACAGAACT GGAGGTGGTG GTCATGGACT 
0361 GGCTGGCCAA GTTCCTGAAG CTGCCCGCAC ACTTCCAGCA CGCCAGCGAT GGACCAGGAG 
0421 GCGGGGTGAT CCAGGGATCA GCTAGCGAGG CTGTGTTGGT GGCTGTCCTA GCTGCCAGGG 
0481 AACAATGCTG TGGCCAACTA C 
 in silico PCR Fragment
0001 TGGATGCCAA GGAGTTTCGG GAATTCGGCA AGGCCGCCAT TGACTACATA GCCGACTATC 
0061 TGGAGAATAT TCGGGATGAC GACGTACTGC CCAATGTGGA GCCAGGCTAT CTGTTGGACC 
0121 TGCTGCCCAC AGAGATGCCG GAAGAGCCCG AAGCGTGGAA GGATGTCCTC GGCGACATTA 
0181 GTCGCGTCAT CAAGCCGGGA CTGACCCACT GGCAGTCGCC TCACATGCAT GCCTACTACC 
0241 CCACCAGCAC CTCGTATCCC TCCATTGTGG GCGAGATGCT GGCCAGCGGG TTCGGCGTCA 
0301 TCGGATTCAG CTGGATCTGC AGTCCCGCCT GCACAGAACT GGAGGTGGTG GTCATGGACT 
0361 GGCTGGCCAA GTTCCTGAAG CTGCCCGCAC ACTTCCAGCA CGCCAGCGAT GGACCAGGAG 
0421 GCGGGGTGAT CCAGGGATCA GCTAGCGAGG CTGTGTTGGT GGCTGTCCTA GCTGCCAGGG 
0481 AACAA-GCTG TGGCCAACTA C 
 Assemble Data

10501R-1.IR_full       1   TGGATGCCAAGGAGTTTCGGGAATTCGGCAAGGCCGCCATTGACTACATAGCCGACTATC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     1   TGGATGCCAAGGAGTTTCGGGAATTCGGCAAGGCCGCCATTGACTACATAGCCGACTATC 60


10501R-1.IR_full       61  TGGAGAATATTCGGGATGACGACGTACTGCCCAATGTGGAGCCAGGCTATCTGTTGGACC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     61  TGGAGAATATTCGGGATGACGACGTACTGCCCAATGTGGAGCCAGGCTATCTGTTGGACC 120


10501R-1.IR_full       121 TGCTGCCCACAGAGATGCCGGAAGAGCCCGAAGCGTGGAAGGATGTCCTCGGCGACATTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     121 TGCTGCCCACAGAGATGCCGGAAGAGCCCGAAGCGTGGAAGGATGTCCTCGGCGACATTA 180


10501R-1.IR_full       181 GTCGCGTCATCAAGCCGGGACTGACCCACTGGCAGTCGCCTCACATGCATGCCTACTACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     181 GTCGCGTCATCAAGCCGGGACTGACCCACTGGCAGTCGCCTCACATGCATGCCTACTACC 240


10501R-1.IR_full       241 CCACCAGCACCTCGTATCCCTCCATTGTGGGCGAGATGCTGGCCAGCGGGTTCGGCGTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     241 CCACCAGCACCTCGTATCCCTCCATTGTGGGCGAGATGCTGGCCAGCGGGTTCGGCGTCA 300


10501R-1.IR_full       301 TCGGATTCAGCTGGATCTGCAGTCCCGCCTGCACAGAACTGGAGGTGGTGGTCATGGACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     301 TCGGATTCAGCTGGATCTGCAGTCCCGCCTGCACAGAACTGGAGGTGGTGGTCATGGACT 360


10501R-1.IR_full       361 GGCTGGCCAAGTTCCTGAAGCTGCCCGCACACTTCCAGCACGCCAGCGATGGACCAGGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     361 GGCTGGCCAAGTTCCTGAAGCTGCCCGCACACTTCCAGCACGCCAGCGATGGACCAGGAG 420


10501R-1.IR_full       421 GCGGGGTGATCCAGGGATCAGCTAGCGAGGCTGTGTTGGTGGCTGTCCTAGCTGCCAGGG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10501R-1.in silico     421 GCGGGGTGATCCAGGGATCAGCTAGCGAGGCTGTGTTGGTGGCTGTCCTAGCTGCCAGGG 480


10501R-1.IR_full       481 AACAATGCTGTGGCCAACTAC 501
                           ||||| |||||||||||||||
10501R-1.in silico     481 AACAA-GCTGTGGCCAACTAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057244.3  CG10501-RA, transcript variant A (amd), mRNA 
35.47   171  14  14  NM_165278.1  CG10501-RB, transcript variant B (amd), mRNA 
0.2   NM_140314.2  CG10698-RA (GRHRII), mRNA 
0   13  37  NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
0   13  37  NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
0   13  37  NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_132203.2  CG15333-RA (CG15333), mRNA 
0   NM_134993.1  CG15440-RA (CG15440), mRNA 
0   NM_057337.2  CG3978-RA, transcript variant A (pnr), mRNA 
0   NM_143259.1  CG5521-RA (CG5521), mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_142882.1  CG17083-RA (CG17083), mRNA 
0   NM_143613.2  CG12063-RA (CG12063), mRNA 
0   NM_165812.1  CG30029-RA (CG30029), mRNA 
0   NM_134900.2  CG17260-RA (CG17260), mRNA 
0   NM_139648.1  CG15022-RA (CG15022), mRNA 
0   NM_164568.1  CG31773-RA (CG31773), mRNA 
0   NM_079221.2  CG7018-RB, transcript variant B (Ets65A), mRNA 
0   NM_079985.2  CG5206-RA (bon), mRNA 
0   NM_137133.2  CG10143-RA (Adgf-E), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_167739.2  CG1801-RA (CG1801), mRNA 
0   NM_167127.1  CG32726-RA (CG32726), mRNA 
0   NM_130555.1  CG14772-RA (CG14772), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   13  32  NM_078955.2  CG3454-RA (Hdc), mRNA 
0   NM_165026.1  CG16975-RA, transcript variant A (CG16975), mRNA 
0   NM_135762.2  CG16975-RB, transcript variant B (CG16975), mRNA 
0   NM_132977.1  CG12997-RA (CG12997), mRNA 
0   NM_176068.2  CG15218-RA, transcript variant A (CycK), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.