National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10496R-3 
 Symbol CG10496  Full Name CG10496 
 CG No CG10496  Old CG No CG10496 
 Synonyms CG10496 
 Accession No (Link to NCBI) NM_137741.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAGCTCTCAATTCGGCCAAA 
 Primer Seq. 3'
aatctagaggtaccTAATCGTAGCTGTCCCTGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAGCTCTCA ATTCGGCCAA ATACAGTGCC CAGGTCAAGA CCAAAACTAG TGACAACGAA 
0061 TCCGATTCCG AAGATGATCT TCCGCCGGAT CAAGATGCGG AGGATAACAA TGAGCCAGAT 
0121 AATCTGCGCC AGCATTTTGG AAAATGCGCC GCACTTCTCT TATCCCGGCT TGAACACTGG 
0181 AATGTTGGGC CAACTCTTGT ACGATCATCA GGATAATCCG AAGCAGGACT TGCCAAATTG 
0241 CTCGGTTACG GTGCCGCTAC CCCTCTTCCT GGCAAAGGAT GGACAAACTC CCCGAGTGGA 
0301 GGCATGCGTC CAAAGGCCAT TCCGCTACGA CGATTGGACA CGGCAATTGC AATTAGGCAA 
0361 GGCTATATTT GATAGGCGAC TTAAAAATAT GAGACAGCGT GTACAGAAGC AGGAGCAAGG 
0421 TGTACACGAT GCCAGTCTGT TTGAGATGGC TGAGCACATA GCCCAACAGG AGAATTCCTT 
0481 CTTCAGGGAC AGCTACGATT A 
 in silico PCR Fragment
0001 ACAGCTCTCA ATTCGGCCAA ATACAGTGCC CAGGTCAAGA CCAAAACTAG TGACAACGAA 
0061 TCCGATTCCG AAGATGATCT TCCGCCGGAT CAAGATGCTG AGGATAACAA TGAGCCAGAT 
0121 AATCTGCG-C AGCATTTTGG AAAATGCGCC GCACTTCTCT TATCCCGGCT TGAACACTGG 
0181 AATGTTGGGC CAACTCTTGT ACGATCATCA GGATAATCCG AAGCAGGACT TGCCAAATTG 
0241 CTCGGTTACG GTGCCGCTAC CCCTCTTCCT GGCAAAGGAT GGACAAACTC CCCGAGTGGA 
0301 GGCATGCGTC CAAAGGCCAT TCCGCTACGA CGATTGGACA CGGCAATTGC AATTAGGCAA 
0361 GGCTATATTT GATAGGCGAC TTAAAAATAT GAGACAGCGT GTACAGAAGC AGGAGCAAGG 
0421 TGTACACGAT GCCAGTCTGT TTGAGATGGC TGAGCACATA GCCCAACAGG AGAATTCCTT 
0481 CTTCAGGGAC AGCTACGATT A 
 Assemble Data

10496R-3.IR_full       1   ACAGCTCTCAATTCGGCCAAATACAGTGCCCAGGTCAAGACCAAAACTAGTGACAACGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10496R-3.in silico     1   ACAGCTCTCAATTCGGCCAAATACAGTGCCCAGGTCAAGACCAAAACTAGTGACAACGAA 60


10496R-3.IR_full       61  TCCGATTCCGAAGATGATCTTCCGCCGGATCAAGATGCGGAGGATAACAATGAGCCAGAT 120
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
10496R-3.in silico     61  TCCGATTCCGAAGATGATCTTCCGCCGGATCAAGATGCTGAGGATAACAATGAGCCAGAT 120


10496R-3.IR_full       121 AATCTGCGCCAGCATTTTGGAAAATGCGCCGCACTTCTCTTATCCCGGCTTGAACACTGG 180
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
10496R-3.in silico     121 AATCTGCG-CAGCATTTTGGAAAATGCGCCGCACTTCTCTTATCCCGGCTTGAACACTGG 180


10496R-3.IR_full       181 AATGTTGGGCCAACTCTTGTACGATCATCAGGATAATCCGAAGCAGGACTTGCCAAATTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10496R-3.in silico     181 AATGTTGGGCCAACTCTTGTACGATCATCAGGATAATCCGAAGCAGGACTTGCCAAATTG 240


10496R-3.IR_full       241 CTCGGTTACGGTGCCGCTACCCCTCTTCCTGGCAAAGGATGGACAAACTCCCCGAGTGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10496R-3.in silico     241 CTCGGTTACGGTGCCGCTACCCCTCTTCCTGGCAAAGGATGGACAAACTCCCCGAGTGGA 300


10496R-3.IR_full       301 GGCATGCGTCCAAAGGCCATTCCGCTACGACGATTGGACACGGCAATTGCAATTAGGCAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10496R-3.in silico     301 GGCATGCGTCCAAAGGCCATTCCGCTACGACGATTGGACACGGCAATTGCAATTAGGCAA 360


10496R-3.IR_full       361 GGCTATATTTGATAGGCGACTTAAAAATATGAGACAGCGTGTACAGAAGCAGGAGCAAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10496R-3.in silico     361 GGCTATATTTGATAGGCGACTTAAAAATATGAGACAGCGTGTACAGAAGCAGGAGCAAGG 420


10496R-3.IR_full       421 TGTACACGATGCCAGTCTGTTTGAGATGGCTGAGCACATAGCCCAACAGGAGAATTCCTT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10496R-3.in silico     421 TGTACACGATGCCAGTCTGTTTGAGATGGCTGAGCACATAGCCCAACAGGAGAATTCCTT 480


10496R-3.IR_full       481 CTTCAGGGACAGCTACGATTA 501
                           |||||||||||||||||||||
10496R-3.in silico     481 CTTCAGGGACAGCTACGATTA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137741.2  CG10496-RA (CG10496), mRNA 
0   NM_142255.2  CG4221-RA (CG4221), mRNA 
0   NM_165329.1  CG10947-RC, transcript variant C (CG10947), mRNA 
0   NM_136187.2  CG10947-RA, transcript variant A (CG10947), mRNA 
0   NM_165328.1  CG10947-RB, transcript variant B (CG10947), mRNA 
0   NM_132725.2  CG1461-RA (CG1461), mRNA 
0   NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
0   NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   NM_137581.2  CG11242-RA (CG11242), mRNA 
0   NM_057960.3  CG7693-RA, transcript variant A (fray), mRNA 
0   NM_169823.1  CG7693-RB, transcript variant B (fray), mRNA 
0   NM_141594.1  CG11970-RA (CG11970), mRNA 
0   NM_140688.2  CG7728-RA (CG7728), mRNA 
0   10  NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   NM_164758.1  CG6976-RB, transcript variant B (Myo28B1), mRNA 
0   NM_164759.1  CG6976-RC, transcript variant C (Myo28B1), mRNA 
0   NM_144373.2  CG6976-RA, transcript variant A (Myo28B1), mRNA 
0   NM_164760.1  CG6976-RD, transcript variant D (Myo28B1), mRNA 
0   NM_167310.1  CG10347-RB, transcript variant B (CG10347), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.