National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10496R-1 
 Symbol CG10496  Full Name CG10496 
 CG No CG10496  Old CG No CG10496 
 Synonyms CG10496 
 Accession No (Link to NCBI) NM_137741.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACAGCTCTCAATTCGGCCAAATACAGTGCCCAGGTCAAGACCAAAACTAGTGACAACGAA 60

                           |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     61  TCCGATTCCGAAGATGATCTTCCGCCGGATCAAGATGCTGAGGATAACAATGAGCCAGAT 120

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AATCTGCG-CAGCATTTTGGAAAATGCGCCGCACTTCTCTTATCCCGGCTTGAACACTGG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AATGTTGGGCCAACTCTTGTACGATCATCAGGATAATCCGAAGCAGGACTTGCCAAATTG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTCGGTTACGGTGCCGCTACCCCTCTTCCTGGCAAAGGATGGACAAACTCCCCGAGTGGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGCATGCGTCCAAAGGCCATTCCGCTACGACGATTGGACACGGCAATTGCAATTAGGCAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGCTATATTTGATAGGCGACTTAAAAATATGAGACAGCGTGTACAGAAGCAGGAGCAAGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGTACACGATGCCAGTCTGTTTGAGATGGCTGAGCACATAGCCCAACAGGAGAATTCCTT 480

10496R-1.IR_full       481 CTTCAGGGACAGCTACGATTA 501
                           ||||||||||||||||||||| silico     481 CTTCAGGGACAGCTACGATTA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137741.2  CG10496-RA (CG10496), mRNA 
0   NM_142255.2  CG4221-RA (CG4221), mRNA 
0   NM_165329.1  CG10947-RC, transcript variant C (CG10947), mRNA 
0   NM_136187.2  CG10947-RA, transcript variant A (CG10947), mRNA 
0   NM_165328.1  CG10947-RB, transcript variant B (CG10947), mRNA 
0   NM_132725.2  CG1461-RA (CG1461), mRNA 
0   NM_165224.1  CG7100-RH, transcript variant H (CadN), mRNA 
0   NM_165225.1  CG7100-RB, transcript variant B (CadN), mRNA 
0   NM_165226.1  CG7100-RF, transcript variant F (CadN), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 
0   NM_001032107.1  CG7100-RK, transcript variant K (CadN), mRNA 
0   NM_001032106.1  CG7100-RL, transcript variant L (CadN), mRNA 
0   NM_137581.2  CG11242-RA (CG11242), mRNA 
0   NM_057960.3  CG7693-RA, transcript variant A (fray), mRNA 
0   NM_169823.1  CG7693-RB, transcript variant B (fray), mRNA 
0   NM_141594.1  CG11970-RA (CG11970), mRNA 
0   NM_140688.2  CG7728-RA (CG7728), mRNA 
0   10  NM_132317.1  CG12121-RA (CG12121), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   NM_164758.1  CG6976-RB, transcript variant B (Myo28B1), mRNA 
0   NM_164759.1  CG6976-RC, transcript variant C (Myo28B1), mRNA 
0   NM_144373.2  CG6976-RA, transcript variant A (Myo28B1), mRNA 
0   NM_164760.1  CG6976-RD, transcript variant D (Myo28B1), mRNA 
0   NM_167310.1  CG10347-RB, transcript variant B (CG10347), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.