National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10478R-1 
 Symbol CG10478  Full Name CG10478 
 CG No CG10478  Old CG No CG10478 
 Synonyms g7295403, CG11040, CG10478 
 Accession No (Link to NCBI) NM_139750.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGCGGACGCTTCGATTGGAAAAAGCCAAAAAGGCTGAGCTCCAGAAAGAGCTGACTATTT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACAATGCTTTAACCAAATGTAAATTAACCTCCTCGGAAGTTGTTCCCGACGTCAATAAGT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TACTTAAGAGCAATACGATAGGAAACCTGGTGGAGTCCCTTGGCCACGGAAATAAGAACA 180

                           |||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||| silico     181 AAATTCGAGCCGACGCCGCAGATGCT-TTAGC-TCATATAGCCAGTGGCTCATCGGAGCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTCAAATTTAATTGCGAAGGCTGGCGCCGTGCCACGATTGATTCGCCTTCTTCAGTCACC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGATCCTGAAGTCTGCGAAAAGGGTATATTGAGTTTGGGGAATCTCTTGCACTTTGCTCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAACCTCCGTGACTATATCATAAGACACGGACTTATGCAAAAGCTGATGTCTATTATTCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGATAAAAGCACTTGCACTTTAATGTTGAGTCATGTAACCTGGGTTCTAAGAAAACTGTG 480

10478R-1.IR_full       481 CATAAGCTCTCAACCATCGCCA 502
                           |||||||||||||||||||||| silico     481 CATAAGCTCTCAACCATCGCCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139750.1  CG10478-RA (CG10478), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_001032407.1  CG33956-RA, transcript variant A (kay), mRNA 
0   NM_001043313.1  CG34155-RA (CG34155), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_141237.1  CG14655-RA (CG14655), mRNA 
0   NM_167075.1  CG3314-RC, transcript variant C (RpL7A), mRNA 
0   NM_078508.4  CG3314-RD, transcript variant D (RpL7A), mRNA 
0   NM_167073.1  CG3314-RA, transcript variant A (RpL7A), mRNA 
0   NM_141156.2  CG11241-RA (CG11241), mRNA 
0   69  73  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   69  73  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_137701.2  CG4030-RA (CG4030), mRNA 
0   NM_166466.2  CG10082-RA, transcript variant A (CG10082), mRNA 
0   NM_141130.3  CG11489-RB, transcript variant B (CG11489), mRNA 
0   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 
0   NM_144375.2  CG1652-RA (lectin-46Cb), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_001014486.1  CG4952-RG, transcript variant G (dac), mRNA 
0   NM_165162.1  CG4952-RB, transcript variant B (dac), mRNA 
0   NM_165161.1  CG4952-RD, transcript variant D (dac), mRNA 
0   NM_001014487.1  CG4952-RF, transcript variant F (dac), mRNA 
0   NM_165163.1  CG4952-RE, transcript variant E (dac), mRNA 
0   NM_165159.1  CG4952-RC, transcript variant C (dac), mRNA 
0   NM_165160.1  CG4952-RA, transcript variant A (dac), mRNA 
0   NM_168554.1  CG32130-RD, transcript variant D (stv), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.