National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10475R-1 
 Symbol Jon65Ai  Full Name Jonah 65Ai 
 CG No CG10475  Old CG No CG10475 
 Synonyms CG10475, CT29408, Jon65A, SP145, Jon65Ai 
 Accession No (Link to NCBI) NM_139758.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTCGAGAAGCCGGTTTTCTG 
 Primer Seq. 3'
aatctagaggtaccCGGAGTTTTCGCCAATCTGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTTCGAGAAG CCGGTTTTCT GGAAGGATGT GCCCGTGTGG CAAGAGCCTC GATCGAGGGT 
0061 AGGATCACCA TGGGATATCC TGCCTACGAA GGCAAGGTGC CCTACATTGT CGGCTTGGGC 
0121 TTCAGCAAGA ACGGTGGAGG GCACCTGGTG CGGCGGTTCC ATTATCGGCA ACACCTGGGT 
0181 GATGACCGCC AAGCATTGTA CCGATGGCAT GGAATCGGTG ACCATCTACT ACGGANCCCT 
0241 CTGGCgCCTG CAGGCACAGT NACACCCACT GGGTGGGACG TAGCGACTTC ATTGAGCACG 
0301 GATCTGGAGA TATCTCCCTC ATTCGCACTC CCCACGTAGA CTTCTGGTCG CTGGTCAACA 
0361 AGGTGGAGCT CCCCAGGTAC GACGATCGCT ACAACAACTA CCAAGGCTGG TGGGCTCTGG 
0421 TCTCCGGATG GGGCAAGACC TCCGATGAGG GCGGTGTCTC CGAGTACCTG ANNTGCGTCG 
0481 ATGTCCAGAT TGGCGAAAAC TCCG 
 in silico PCR Fragment
0001 GTTCGAGAAG CCGGTTTTCT GGAAGGATGT GCCCGTG-GG CAAG-GCCTC GATCGAAGGT 
0061 AGGATCACCA TGGGATATCC TGCCTACGAA GGCAAGGTGC CCTACATTGT CGGTTTGGGC 
0121 TTCAGCAAGA ACGGTGGA-G GCACCTGGTG CGGCGGTTCC ATTATCGGCA ACACCTGGGT 
0181 GATGACCGCC AAGCATTGTA CCGATGGCAT GGAATCGGTG ACCATCTACT ACGGAGCCCT 
0241 CTGGCGCCTG CAGGCACAGT -ACACCCACT GGGTGGGACG TAGCGACTTC ATTGAGCACG 
0301 GATCTGGAGA CATCTCCCTC ATTCGCACTC CCCACGTAGA CTTCTGGTCG CTGGTCAACA 
0361 AGGTGGAGCT CCCCAGGTAC GACGATCGCT ACAACAACTA CCAAGGCTGG TGGGCTCTGG 
0421 TCTCCGGATG GGGCAAGACC TCCGATGAGG GCGGTGTCTC CGAGTACCTG AACTGCGTCG 
0481 ATGTCCAGAT TGGCGAAAAC TCCG 
 Assemble Data

10475R-1.IR_full        1   TTCGAGAAGCCGGTTTTCTGGAAGGATGTGCCCGTGTGGCAAGAGCCTCGATCGAGGGT 59
                            |||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||
10475R-1.in silico      1   TTCGAGAAGCCGGTTTTCTGGAAGGATGTGCCCGTG-GGCAAG-GCCTCGATCGAAGGT 59


10475R-1.IR_full       61  AGGATCACCATGGGATATCCTGCCTACGAAGGCAAGGTGCCCTACATTGTCGGCTTGGGC 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
10475R-1.in silico     61  AGGATCACCATGGGATATCCTGCCTACGAAGGCAAGGTGCCCTACATTGTCGGTTTGGGC 119


10475R-1.IR_full       121 TTCAGCAAGAACGGTGGAGGGCACCTGGTGCGGCGGTTCCATTATCGGCAACACCTGGGT 179
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
10475R-1.in silico     121 TTCAGCAAGAACGGTGGA-GGCACCTGGTGCGGCGGTTCCATTATCGGCAACACCTGGGT 179


10475R-1.IR_full       181 GATGACCGCCAAGCATTGTACCGATGGCATGGAATCGGTGACCATCTACTACGGANCCCT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
10475R-1.in silico     181 GATGACCGCCAAGCATTGTACCGATGGCATGGAATCGGTGACCATCTACTACGGAGCCCT 239


10475R-1.IR_full       241 CTGGCGCCTGCAGGCACAGTNACACCCACTGGGTGGGACGTAGCGACTTCATTGAGCACG 299
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
10475R-1.in silico     241 CTGGCGCCTGCAGGCACAGT-ACACCCACTGGGTGGGACGTAGCGACTTCATTGAGCACG 299


10475R-1.IR_full       301 GATCTGGAGATATCTCCCTCATTCGCACTCCCCACGTAGACTTCTGGTCGCTGGTCAACA 359
                           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
10475R-1.in silico     301 GATCTGGAGACATCTCCCTCATTCGCACTCCCCACGTAGACTTCTGGTCGCTGGTCAACA 359


10475R-1.IR_full       361 AGGTGGAGCTCCCCAGGTACGACGATCGCTACAACAACTACCAAGGCTGGTGGGCTCTGG 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10475R-1.in silico     361 AGGTGGAGCTCCCCAGGTACGACGATCGCTACAACAACTACCAAGGCTGGTGGGCTCTGG 419


10475R-1.IR_full       421 TCTCCGGATGGGGCAAGACCTCCGATGAGGGCGGTGTCTCCGAGTACCTGANNTGCGTCG 479
                           |||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||
10475R-1.in silico     421 TCTCCGGATGGGGCAAGACCTCCGATGAGGGCGGTGTCTCCGAGTACCTGAACTGCGTCG 479


10475R-1.IR_full       481 ATGTCCAGATTGGCGAAAACTCCG 503
                           ||||||||||||||||||||||||
10475R-1.in silico     481 ATGTCCAGATTGGCGAAAACTCCG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
2.9   14  25  36  56  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
1.86   14  41  78  NM_165618.1  CG8579-RA (Jon44E), mRNA 
1.45   18  24  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0.82   33  39  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0.82   33  39  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0.41   20  38  62  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.41   14  31  61  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0.41   12  41  64  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
0.41   12  30  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
0.2   NM_132515.2  CG1841-RA, transcript variant A (Tango10), mRNA 
0.2   NM_167302.1  CG1841-RB, transcript variant B (Tango10), mRNA 
0   19  54  63  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
0   12  43  58  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   37  52  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   37  44  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
0   14  NM_139753.1  CG10477-RA (CG10477), mRNA 
0   11  NM_079220.1  CG6457-RA (yip7), mRNA 
0   11  NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_167522.2  CG4429-RB, transcript variant B (Rbp2), mRNA 
0   NM_080220.2  CG4429-RA, transcript variant A (Rbp2), mRNA 
0   NM_206764.1  CG4429-RC, transcript variant C (Rbp2), mRNA 
0   NM_166537.1  CG4329-RB, transcript variant B (CG4329), mRNA 
0   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0   NM_137530.1  CG15080-RA (CG15080), mRNA 
0   NM_139760.1  CG10472-RA (CG10472), mRNA 
0   NM_001014583.1  CG32134-RB, transcript variant B (btl), mRNA 
0   NM_168577.2  CG32134-RA, transcript variant A (btl), mRNA 
0   NM_130594.1  CG14803-RA (CG14803), mRNA 
0   11  18  NM_140084.1  CG18180-RA (CG18180), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.