National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10473R-3 
 Symbol hkl  Full Name hook-like 
 CG No CG10473  Old CG No CG10473 
 Synonyms hkl, CG10473, l(2)37Ba, Ba, CG10437 
 Accession No (Link to NCBI) NM_136091.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           | ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     1   GACGACGCCTAGAAAGCGCACGGAGTCCAAGGGCGGCGACAAGAAGGTGGACACCATACC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGAGGAGGAGCCGGAGAATGGAAAGGATGTTGAAAAGGACGCTGTCGAGGAGGAAAAGAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGTAGCGCCACCCGCGGCTAATGAGAGCGAGTCCGAGGACCGTGCCAAGACGGAGGATCA 180

                           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCAGGCTCAAGACGATGAATCCTGTGCTGAACCCGCTGTAGTCAAGGATGATGATGTTGA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAAAGAGGACTTAAAACCGCAGCAGGAGGTCCCCACTTCCACTGATGATGACACCAAGCA 300

                           || | |||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     301 GAGCGAGCCAGAACAAGAGGTAAAGGTTCCTTCTCCTTCCAGCAAGGATGAGGAACATCT 360

                           |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| silico     361 AAAAACGACTAGTGATGTATTAGACATTCAGACAGAAGAGGTCGATGAAAGGGACGAAGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCCTCCGCTCCTGCGGAGCGCAGAGAAACCAAGAAGAGGCACAAGGAGCAGATAAAGGA 480

10473R-3.IR_full       481 ACAGCAACCCGCAGAGGAGG 500
                           |||||||||||||||||||| silico     481 ACAGCAACCCGCAGAGGAGG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165273.1  CG10473-RB, transcript variant B (CG10473), mRNA 
100   482  NM_136091.3  CG10473-RA, transcript variant A (CG10473), mRNA 
0   NM_205938.1  CG13401-RB, transcript variant B (U26), mRNA 
0   NM_135386.3  CG13401-RA, transcript variant A (U26), mRNA 
0   NM_140603.1  CG13049-RB, transcript variant B (CG13049), mRNA 
0   NM_168657.1  CG13049-RA, transcript variant A (CG13049), mRNA 
0   13  NM_137755.2  CG15675-RA, transcript variant A (CG15675), mRNA 
0   NM_080369.2  CG12055-RA, transcript variant A (Gapdh1), mRNA 
0   NM_001038847.1  CG12055-RB, transcript variant B (Gapdh1), mRNA 
0   NM_169632.1  CG6384-RB, transcript variant B (Cp190), mRNA 
0   NM_079635.2  CG6384-RA, transcript variant A (Cp190), mRNA 
0   NM_080139.3  CG8171-RA (dup), mRNA 
0   NM_143336.1  CG5003-RA (CG5003), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   NM_057660.2  CG4758-RA, transcript variant A (Trp1), mRNA 
0   NM_164885.1  CG4758-RB, transcript variant B (Trp1), mRNA 
0   NM_166876.1  CG14622-RB, transcript variant B (DAAM), mRNA 
0   NM_166875.1  CG14622-RC, transcript variant C (DAAM), mRNA 
0   NM_130544.3  CG14622-RA, transcript variant A (DAAM), mRNA 
0   NM_058143.3  CG3218-RA (fs(1)K10), mRNA 
0   NM_078564.2  CG1594-RA (hop), mRNA 
0   NM_166443.1  CG9485-RA, transcript variant A (CG9485), mRNA 
0   NM_166444.1  CG9485-RB, transcript variant B (CG9485), mRNA 
0   NM_137733.2  CG9485-RC, transcript variant C (CG9485), mRNA 
0   NM_132895.2  CG9984-RA (TH1), mRNA 
0   NM_141608.2  CG18005-RA (CG18005), mRNA 
0   NM_167276.1  CG1938-RB, transcript variant B (Dlic2), mRNA 
0   NM_167274.1  CG1938-RD, transcript variant D (Dlic2), mRNA 
0   NM_132466.2  CG1938-RA, transcript variant A (Dlic2), mRNA 
0   NM_167273.1  CG1938-RC, transcript variant C (Dlic2), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.