National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10465R-3 
 Symbol CG10465  Full Name CG10465 
 CG No CG10465  Old CG No CG10465 
 Synonyms CG10465 
 Accession No (Link to NCBI) NM_136321.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAAGCCAATTTGCCGCATTC 
 Primer Seq. 3'
aatctagaggtaccCCAGTGCGTTCTTCTTCCTCA 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 CAAAgCCAAT TTGCCGCATT CCACTTATAA CTTCACAAAA GGAAGAGCAG CTTTTATTAA 
0061 GTGTTTCTTT AAAGCCGGCT GTTATTCTTG TGGTTCAGCG GCAGAATAAC AAGTATTCGT 
0121 ACACAAGTAC ATCAGACGAC AACTTATTAA AAAAATATTG AATTATTTGA TAAGCTTTCT 
0181 TTGCGCTTTA ACGAACGAAT TTTGTTTATT AAAGACGTAA TTGGGCCAAG TGAAATCTGC 
0241 TGCTGGTCAT TTTACGGACA CGGAAAAAAA GTAGCTGAAG TGTGTTGCAC TTCAATAGTT 
0301 TATGCAACTG ACAGAAAGCA TACTAAAGTT GAATTTCCGG AAGCTCGTAT ATACGAAGAA 
0361 ACGCTACAAG TCTTGCTTTA TGAAAACCGC AATGCACCAG ACCAAGAGCT CATGCAGGCA 
0421 ACGTCTTCAG CACGAGTAGG AAGTGCAAGT GGAACCAGCA TTAATCAGTA CACAAGCGAT 
0481 GAGGAAGAAG AACGCACTGG  
 in silico PCR Fragment
0001 CAAAGCCAAT TTGCCGCATT CCACTTATAA CTTCACAAAA GGAAGAGCAG CTTTTATTAA 
0061 GTGTTTCTTT AAAGCCGGCT GTTATTCTTG TGGTTCAGCG GCAGAATAAC AAGTATTCGT 
0121 ACACAAGTAC ATCAGACGAC AACTTATT-A AAAAATATTG AATTATTTGA TAAGCTTTCT 
0181 TTGCGCTTTA ACGAACGAAT TTTGTTTATT AAAGACGTAA TTGGGCCAAG TGAAATCTGC 
0241 TGCTGGTCAT TTTACGGACA CGGAAAAAAA GTAGCTGAAG TGTGTTGCAC TTCAATAGTT 
0301 TATGCAACTG ACAGAAAGCA TACTAAAGTT GAATTTCCGG AAGCTCGTAT ATACGAAGAA 
0361 ACGCTACAAG TCTTGCTTTA TGAAAACCGC AATGCACCAG ACCAAGAGCT CATGCAGGCA 
0421 ACGTCTTCAG CACGAGTAGG AAGTGCAAGT GGAACCAGCA TTAATCAGTA CACAAGCGAT 
0481 GAGGAAGAAG AACGCACTGG  
 Assemble Data

10465R-3.IR_full       1   CAAAGCCAATTTGCCGCATTCCACTTATAACTTCACAAAAGGAAGAGCAGCTTTTATTAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10465R-3.in silico     1   CAAAGCCAATTTGCCGCATTCCACTTATAACTTCACAAAAGGAAGAGCAGCTTTTATTAA 60


10465R-3.IR_full       61  GTGTTTCTTTAAAGCCGGCTGTTATTCTTGTGGTTCAGCGGCAGAATAACAAGTATTCGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10465R-3.in silico     61  GTGTTTCTTTAAAGCCGGCTGTTATTCTTGTGGTTCAGCGGCAGAATAACAAGTATTCGT 120


10465R-3.IR_full       121 ACACAAGTACATCAGACGACAACTTATTAAAAAAATATTGAATTATTTGATAAGCTTTCT 180
                           |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||
10465R-3.in silico     121 ACACAAGTACATCAGACGACAACTTATT-AAAAAATATTGAATTATTTGATAAGCTTTCT 180


10465R-3.IR_full       181 TTGCGCTTTAACGAACGAATTTTGTTTATTAAAGACGTAATTGGGCCAAGTGAAATCTGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10465R-3.in silico     181 TTGCGCTTTAACGAACGAATTTTGTTTATTAAAGACGTAATTGGGCCAAGTGAAATCTGC 240


10465R-3.IR_full       241 TGCTGGTCATTTTACGGACACGGAAAAAAAGTAGCTGAAGTGTGTTGCACTTCAATAGTT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10465R-3.in silico     241 TGCTGGTCATTTTACGGACACGGAAAAAAAGTAGCTGAAGTGTGTTGCACTTCAATAGTT 300


10465R-3.IR_full       301 TATGCAACTGACAGAAAGCATACTAAAGTTGAATTTCCGGAAGCTCGTATATACGAAGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10465R-3.in silico     301 TATGCAACTGACAGAAAGCATACTAAAGTTGAATTTCCGGAAGCTCGTATATACGAAGAA 360


10465R-3.IR_full       361 ACGCTACAAGTCTTGCTTTATGAAAACCGCAATGCACCAGACCAAGAGCTCATGCAGGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10465R-3.in silico     361 ACGCTACAAGTCTTGCTTTATGAAAACCGCAATGCACCAGACCAAGAGCTCATGCAGGCA 420


10465R-3.IR_full       421 ACGTCTTCAGCACGAGTAGGAAGTGCAAGTGGAACCAGCATTAATCAGTACACAAGCGAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10465R-3.in silico     421 ACGTCTTCAGCACGAGTAGGAAGTGCAAGTGGAACCAGCATTAATCAGTACACAAGCGAT 480


10465R-3.IR_full       481 GAGGAAGAAGAACGCACTGG 500
                           ||||||||||||||||||||
10465R-3.in silico     481 GAGGAAGAAGAACGCACTGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_136321.2  CG10465-RA (CG10465), mRNA 
0   NM_165877.1  CG30203-RA (CG30203), mRNA 
0   NM_001042945.1  CG17715-RD, transcript variant D (CG17715), mRNA 
0   NM_001042942.1  CG17715-RE, transcript variant E (CG17715), mRNA 
0   NM_001042946.1  CG17715-RB, transcript variant B (CG17715), mRNA 
0   NM_001042944.1  CG17715-RA, transcript variant A (CG17715), mRNA 
0   NM_001015171.1  CG41066-PA.3 (CG41066), mRNA 
0   NM_001015274.1  CG40137-PA.3 (CG40137), mRNA 
0   NM_168169.2  CG18769-RB, transcript variant B (CG18769), mRNA 
0   NM_136016.2  CG15150-RA (elfless), mRNA 
0   NM_080253.2  CG5067-RA (cic), mRNA 
0   NM_143141.2  CG4548-RB, transcript variant B (XNP), mRNA 
0   NM_170228.1  CG4548-RA, transcript variant A (XNP), mRNA 
0   NM_165754.1  CG12214-RB, transcript variant B (CG12214), mRNA 
0   NM_001015331.1  CG40092-PA.3 (CG40092), mRNA 
0   NM_169731.1  CG31498-RA (CG31498), mRNA 
0   NM_141130.3  CG11489-RB, transcript variant B (CG11489), mRNA 
0   NM_176386.1  CG11489-RC, transcript variant C (CG11489), mRNA 
0   NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
0   NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
0   NM_057311.4  CG6246-RA (nub), mRNA 
0   NM_079528.2  CG2520-RA (lap), mRNA 
0   NM_079909.2  CG3327-RA, transcript variant A (E23), mRNA 
0   NM_205900.1  CG3327-RC, transcript variant C (E23), mRNA 
0   NM_137096.2  CG8468-RB, transcript variant B (CG8468), mRNA 
0   NM_134924.1  CG3327-RB, transcript variant B (E23), mRNA 
0   NM_140043.3  CG4347-RA, transcript variant A (UGP), mRNA 
0   NM_168325.2  CG4347-RC, transcript variant C (UGP), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_134296.2  CG8676-RB, transcript variant B (Hr39), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.