National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10459R-2 
 Symbol CG10459  Full Name CG10459 
 CG No CG10459  Old CG No CG10459 
 Synonyms CG10459 
 Accession No (Link to NCBI) NM_136669.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGGCACGAGAACTAACTCTATTTTCCTGCCGCACCACGTCAAGTCGTTGGAGCTGCACCA 60

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGCGGCGATATAGTGACCATAGCCTATGCCGGCGGAGTGATCTTCCTGGACCCCAAGAG 120

                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| silico     121 CTTCGAAGTGCTCAAGCATCGC-AAGCTGCCCTACAAGGTGACTGCGGCATCGCTG-AGT 180

                           ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCCAACAAGGGAATCTACGTGTGCGGCAACAACATGGGCTACTCCTTCAAATACGACTAC 240

                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||| silico     241 GACACAGATGTTGATAGGGGTCTTTATGTATCTCAGGAACCAT-CCGCAGTGC-TAGCAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGAGCTTCAGCCCGGATGGCGAGGTGTGTGCCATTGGATCCCAAGATGGCAGTATCATTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCTGGCAAATGAACCCCAAACAGGCGTCTGTAGTGGGCCACCTCAAAGACGAAGACGATG 420

10459R-2.IR_full       421 GGGAGAAGAATGGATCCATCA 441
                           ||||||||||||||||||||| silico     421 GGGAGAAGAATGGATCCATCA 441

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   419  NM_136669.2  CG10459-RA (CG10459), mRNA 
0   NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_141550.2  CG9716-RA (Cyp313b1), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   NM_137273.2  CG8060-RA (CG8060), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 
0   NM_134768.3  CG17660-RA (CG17660), mRNA 
0   NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0   NM_001038795.1  CG8683-RA (CG8683), mRNA 
0   NM_137960.2  CG3957-RA (CG3957), mRNA 
0   NM_135020.2  CG15626-RA, transcript variant A (CG15626), mRNA 
0   NM_164597.1  CG15626-RB, transcript variant B (CG15626), mRNA 
0   NM_080111.2  CG2684-RA (lds), mRNA 
0   NM_136335.2  CG1298-RA (CG1298), mRNA 
0   NM_138055.1  CG30419-RA (CG30419), mRNA 
0   NM_166021.1  CG6671-RC, transcript variant C (AGO1), mRNA 
0   NM_166020.1  CG6671-RA, transcript variant A (AGO1), mRNA 
0   NM_079010.2  CG6671-RB, transcript variant B (AGO1), mRNA 
0   NM_079998.2  CG5912-RA (arr), mRNA 
0   NM_079166.2  CG1044-RA, transcript variant A (dos), mRNA 
0   NM_167956.1  CG1044-RB, transcript variant B (dos), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_143506.3  CG7921-RA, transcript variant A (Mgat2), mRNA 
0   NM_001014684.1  CG7921-RB, transcript variant B (Mgat2), mRNA 
0   NM_136972.2  CG12488-RA (CG12488), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.