National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10459R-1 
 Symbol CG10459  Full Name CG10459 
 CG No CG10459  Old CG No CG10459 
 Synonyms CG10459 
 Accession No (Link to NCBI) NM_136669.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGCACGAGAACTAACTCTAT 
 Primer Seq. 3'
aatctagaggtaccTGATGGATCCATTCTTCTCCC 
 Predicted Fragment Size
437 
 IR fragment full Seq
0001 CGGCACGAGA ACTAACTCTA TTTTCCTGCC GCACCACGTC AAGTCGTTGG AGCTGCACCA 
0061 TAGCGGCGAT ATAGTGACCA TAGCCTATGC CGGCGGAGTG ATCTTCCTGG ACCCCAAGAG 
0121 CTTCGAAGTG CTCAAGCATC GCNAAGCTGC CCTACAAGGT GACTGCGGCA TCGCTGNAGT 
0181 CCCAACAAGG GGATCTACGT GTGCGGCAAC AACATGGGCT ACTCCTTCAA ATACGACTAC 
0241 GACACAGATG TTGATAGGGG TCTTTATGTA TCTCAGGAAC CATNCCGCAG TGCNTAGCAC 
0301 TGAGCTTCAG CCCGGATGGC GAGGTGTGTG CCATTGGATC CCAAGATGGC AGTATCATTC 
0361 TCTGGCAAAT GAACCCCAAA CAGGCGTCTG TAGTGGGCCA CCTCAAAGAC GAAGACGATG 
0421 GGGAGAAGAA TGGATCCATC A 
 in silico PCR Fragment
0001 CGGCACGAGA ACTAACTCTA TTTTCCTGCC GCACCACGTC AAGTCGTTGG AGCTGCACCA 
0061 CAGCGGCGAT ATAGTGACCA TAGCCTATGC CGGCGGAGTG ATCTTCCTGG ACCCCAAGAG 
0121 CTTCGAAGTG CTCAAGCATC GC-AAGCTGC CCTACAAGGT GACTGCGGCA TCGCTG-AGT 
0181 CCCAACAAGG GAATCTACGT GTGCGGCAAC AACATGGGCT ACTCCTTCAA ATACGACTAC 
0241 GACACAGATG TTGATAGGGG TCTTTATGTA TCTCAGGAAC CAT-CCGCAG TGC-TAGCAC 
0301 TGAGCTTCAG CCCGGATGGC GAGGTGTGTG CCATTGGATC CCAAGATGGC AGTATCATTC 
0361 TCTGGCAAAT GAACCCCAAA CAGGCGTCTG TAGTGGGCCA CCTCAAAGAC GAAGACGATG 
0421 GGGAGAAGAA TGGATCCATC A 
 Assemble Data

10459R-1.IR_full       1   CGGCACGAGAACTAACTCTATTTTCCTGCCGCACCACGTCAAGTCGTTGGAGCTGCACCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10459R-1.in silico     1   CGGCACGAGAACTAACTCTATTTTCCTGCCGCACCACGTCAAGTCGTTGGAGCTGCACCA 60


10459R-1.IR_full       61  TAGCGGCGATATAGTGACCATAGCCTATGCCGGCGGAGTGATCTTCCTGGACCCCAAGAG 120
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10459R-1.in silico     61  CAGCGGCGATATAGTGACCATAGCCTATGCCGGCGGAGTGATCTTCCTGGACCCCAAGAG 120


10459R-1.IR_full       121 CTTCGAAGTGCTCAAGCATCGCNAAGCTGCCCTACAAGGTGACTGCGGCATCGCTGNAGT 180
                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||
10459R-1.in silico     121 CTTCGAAGTGCTCAAGCATCGC-AAGCTGCCCTACAAGGTGACTGCGGCATCGCTG-AGT 180


10459R-1.IR_full       181 CCCAACAAGGGGATCTACGTGTGCGGCAACAACATGGGCTACTCCTTCAAATACGACTAC 240
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
10459R-1.in silico     181 CCCAACAAGGGAATCTACGTGTGCGGCAACAACATGGGCTACTCCTTCAAATACGACTAC 240


10459R-1.IR_full       241 GACACAGATGTTGATAGGGGTCTTTATGTATCTCAGGAACCATNCCGCAGTGCNTAGCAC 300
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||
10459R-1.in silico     241 GACACAGATGTTGATAGGGGTCTTTATGTATCTCAGGAACCAT-CCGCAGTGC-TAGCAC 300


10459R-1.IR_full       301 TGAGCTTCAGCCCGGATGGCGAGGTGTGTGCCATTGGATCCCAAGATGGCAGTATCATTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10459R-1.in silico     301 TGAGCTTCAGCCCGGATGGCGAGGTGTGTGCCATTGGATCCCAAGATGGCAGTATCATTC 360


10459R-1.IR_full       361 TCTGGCAAATGAACCCCAAACAGGCGTCTGTAGTGGGCCACCTCAAAGACGAAGACGATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10459R-1.in silico     361 TCTGGCAAATGAACCCCAAACAGGCGTCTGTAGTGGGCCACCTCAAAGACGAAGACGATG 420


10459R-1.IR_full       421 GGGAGAAGAATGGATCCATCA 441
                           |||||||||||||||||||||
10459R-1.in silico     421 GGGAGAAGAATGGATCCATCA 441

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   419  NM_136669.2  CG10459-RA (CG10459), mRNA 
0   NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_141550.2  CG9716-RA (Cyp313b1), mRNA 
0   NM_079114.1  CG11290-RA (enok), mRNA 
0   NM_137273.2  CG8060-RA (CG8060), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 
0   NM_134768.3  CG17660-RA (CG17660), mRNA 
0   NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0   NM_001038795.1  CG8683-RA (CG8683), mRNA 
0   NM_137960.2  CG3957-RA (CG3957), mRNA 
0   NM_135020.2  CG15626-RA, transcript variant A (CG15626), mRNA 
0   NM_164597.1  CG15626-RB, transcript variant B (CG15626), mRNA 
0   NM_080111.2  CG2684-RA (lds), mRNA 
0   NM_136335.2  CG1298-RA (CG1298), mRNA 
0   NM_138055.1  CG30419-RA (CG30419), mRNA 
0   NM_166021.1  CG6671-RC, transcript variant C (AGO1), mRNA 
0   NM_166020.1  CG6671-RA, transcript variant A (AGO1), mRNA 
0   NM_079010.2  CG6671-RB, transcript variant B (AGO1), mRNA 
0   NM_079998.2  CG5912-RA (arr), mRNA 
0   NM_079166.2  CG1044-RA, transcript variant A (dos), mRNA 
0   NM_167956.1  CG1044-RB, transcript variant B (dos), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_143506.3  CG7921-RA, transcript variant A (Mgat2), mRNA 
0   NM_001014684.1  CG7921-RB, transcript variant B (Mgat2), mRNA 
0   NM_136972.2  CG12488-RA (CG12488), mRNA 
0   NM_166200.2  CG8912-RA, transcript variant A (Psi), mRNA 
0   NM_057775.3  CG8912-RB, transcript variant B (Psi), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.