National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10415R-3 
 Symbol TfIIEalpha  Full Name Transcription factor IIEalpha 
 CG No CG10415  Old CG No CG10415 
 Synonyms TfIIEa, TFIIE, TFIIEalpha, TFIIE-L, CG10415, dTFIIEL, dTFIIE-L, TfIIE, TfIIEalpha 
 Accession No (Link to NCBI) NM_079302.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     1   ATGTCGTCGACATCGACGGCTGCAGCGAACGCAGCGCCAGCGAAGACGGAGGTGCGGTAC 60

                           |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| silico     61  GTGACCGAGGTGCCCAGCAGTCTGAA-GCAACTGGCGCGCCTCGTGGTCCGTGGATTCTA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTCCCTGGAGGATGCGCTTATCATCGACATGCTGGTGCGGAATCCCTGCATGAAGGAGGA 180

                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     181 CGACATCGGCGAGCTGTTGCGC-TTCGAGAAGAAGCAGTTAAGGGCCCGGATAACCACGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCGCACCGACAAGTTCATCCAGATCAGGCTTAAAATGGAAACGGGGCCGGATGGTAAGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCAGAAGGTCAATTACTACTTCATCAACTACAAGACCTTCGTGAACGTGGTGAAGTACA 360

                           ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| silico     361 AGCTGGATCTCATGCGCAAGCGTATGG-AGACGGAGGAGCGTGATGCCACCAGTAGAGCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGTTTTAAGTGCTCTTCGTGTTCCAAAACATTCACGGACCTCGAAGCGGACCAGCTGTTC 480

10415R-3.IR_full       481 GACATGGCCACGCTGGAGTTCC 502
                           |||||||||||||||||||||| silico     481 GACATGGCCACGCTGGAGTTCC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_079302.2  CG10415-RA (TfIIEalpha), mRNA 
0.2   NM_130497.2  CG13363-RA (Suv4-20), mRNA 
0.2   NM_140915.3  CG14183-RA (CG14183), mRNA 
0   NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   NM_143262.1  CG14254-RA (CG14254), mRNA 
0   NM_167487.1  CG32577-RA (disco-r), mRNA 
0   NM_166590.1  CG30412-RB, transcript variant B (CG30412), mRNA 
0   NM_137933.2  CG30412-RA, transcript variant A (CG30412), mRNA 
0   NM_167543.1  CG32574-RA (CG32574), mRNA 
0   NM_141189.1  CG14640-RA (CG14640), mRNA 
0   NM_078937.3  CG2411-RA (ptc), mRNA 
0   NM_167540.1  CG32570-RA (CG32570), mRNA 
0   NM_169299.1  CG9495-RA (Scm), mRNA 
0   NM_136059.2  CG10369-RA (Irk3), mRNA 
0   NM_205957.1  CG33304-RA (rho-5), mRNA 
0   NM_143755.2  CG14813-RA (deltaCOP), mRNA 
0   NM_143026.1  CG6879-RA (CG6879), mRNA 
0   NM_140304.2  CG5620-RA, transcript variant A (CG5620), mRNA 
0   NM_206343.1  CG5620-RB, transcript variant B (CG5620), mRNA 
0   NM_079412.2  CG5123-RA (W), mRNA 
0   NM_138050.2  CG3363-RA (CG3363), mRNA 
0   NM_166931.1  CG3707-RB, transcript variant B (wapl), mRNA 
0   NM_080303.2  CG3707-RA, transcript variant A (wapl), mRNA 
0   NM_135134.2  CG9092-RA (Gal), mRNA 
0   16  NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   16  NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_132987.1  CG5613-RA, transcript variant A (CG5613), mRNA 
0   NM_176750.1  CG5613-RB, transcript variant B (CG5613), mRNA 
0   NM_057664.4  CG15444-RB, transcript variant B (ine), mRNA 
0   NM_175959.1  CG15444-RD, transcript variant D (ine), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.