National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10385R-3 
 Symbol msl-1  Full Name male-specific lethal 1 
 CG No CG10385  Old CG No CG10385 
 Synonyms msl, MSL-1, MSL1, Msl1, msl1, MSL, i94, CG10385, mls-1, km(2)B, kmB, msl-1, Msl 1-3, Msl-1 
 Accession No (Link to NCBI) NM_057548.3 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAAGCGGGCCAACTACTTGGA 
 Primer Seq. 3'
aatctagaggtaccTTCGCTGGTTCTTTCGCCGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAAGCGGGCC AACTACTTGG AATCGCCCTA TCCCCACATA CCGTCGCGTG GCCGCCAAAG 
0061 GAATCTGCAC GGCCATCCCA ATCAGACGCA GCATCTTCAT CAGCATCCCG GGAAGATCTA 
0121 TGAGCGCCAG CAATATGGCA ATGGTCGTGG AGGACATGGC GGGGGTAATA ACAACTACCG 
0181 AAAGCTTTTG CATTCGCTGC CAGCTGAGCA TGGTGGCGGA GCCATGNGCT TCCTCCTTCC 
0241 TCCGGCGGAA CCGTGTGTGC CGGCGCCGAT ATGGTCAAGC TCATCTCGGA GAACAACAAC 
0301 CTGAGGCGCA TGGTTATGTT AAACTTAAAC CTGATGCAGG AGCAGACGGA CAGCATAGCG 
0361 GCCAAGGACA AGGAGCTGGA CGACCAAAGC GCTAAGATGA GCGTGGTGAA GGCGCAGAAT 
0421 GAGGAATTAA AGCAGGCCGT TGCTCAGTTG GAGGCCGCCA ACCAGGAACT ATGCAAACAG 
0481 CTGCGGCGAA AGAACCAGCG AA 
 in silico PCR Fragment
0001 AAAGCGGGCC AACTACTTGG AATCGCCCTA TCCCCACATA CCGTCGCGTG GCCGCCAAAG 
0061 GAATCTGCAC GGCCATCCCA ATCAGACGCA GCATCTTCAT CAGCATCCCG GGAAGATCTA 
0121 TGAGCGCCAG CAATATGGCA ATGGTCGTGG AGGACATGGC GGGGGTAATA ACAACTACCG 
0181 AAAGCTTTTG CATTCGCTGC CAGCTGAGCA TGGTGGCGGA GCCATG-GC- TCCTCCTTCC 
0241 TCCGGCGGAA CCGTGTGTGC CGGCGCCGAT ATGGTCAAGC TCATCTCGGA GAACAACAAC 
0301 CTGAGGCGCA TGGTTATGTT GAACTTAAAC CTGATGCAGG AGCAGACGGA CAGCATAGCG 
0361 GCCAAGGACA AGGAGCTGGA CGACCAAAGC GCTAAGATGA GCGTGGTGAA GGCGCAGAAT 
0421 GAGGAATTAA AGCAGGCCGT TGCTCAGTTG GAGGCCGCCA ACCAGGAACT ATGCAAACAG 
0481 CTGCGGCGAA AGAACCAGCG AA 
 Assemble Data

10385R-3.IR_full       1   AAAGCGGGCCAACTACTTGGAATCGCCCTATCCCCACATACCGTCGCGTGGCCGCCAAAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10385R-3.in silico     1   AAAGCGGGCCAACTACTTGGAATCGCCCTATCCCCACATACCGTCGCGTGGCCGCCAAAG 60


10385R-3.IR_full       61  GAATCTGCACGGCCATCCCAATCAGACGCAGCATCTTCATCAGCATCCCGGGAAGATCTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10385R-3.in silico     61  GAATCTGCACGGCCATCCCAATCAGACGCAGCATCTTCATCAGCATCCCGGGAAGATCTA 120


10385R-3.IR_full       121 TGAGCGCCAGCAATATGGCAATGGTCGTGGAGGACATGGCGGGGGTAATAACAACTACCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10385R-3.in silico     121 TGAGCGCCAGCAATATGGCAATGGTCGTGGAGGACATGGCGGGGGTAATAACAACTACCG 180


10385R-3.IR_full       181 AAAGCTTTTGCATTCGCTGCCAGCTGAGCATGGTGGCGGAGCCATGNGCTTCCTCCTTCC 240
                           |||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||
10385R-3.in silico     181 AAAGCTTTTGCATTCGCTGCCAGCTGAGCATGGTGGCGGAGCCATG-GC-TCCTCCTTCC 240


10385R-3.IR_full       241 TCCGGCGGAACCGTGTGTGCCGGCGCCGATATGGTCAAGCTCATCTCGGAGAACAACAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10385R-3.in silico     241 TCCGGCGGAACCGTGTGTGCCGGCGCCGATATGGTCAAGCTCATCTCGGAGAACAACAAC 300


10385R-3.IR_full       301 CTGAGGCGCATGGTTATGTTAAACTTAAACCTGATGCAGGAGCAGACGGACAGCATAGCG 360
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
10385R-3.in silico     301 CTGAGGCGCATGGTTATGTTGAACTTAAACCTGATGCAGGAGCAGACGGACAGCATAGCG 360


10385R-3.IR_full       361 GCCAAGGACAAGGAGCTGGACGACCAAAGCGCTAAGATGAGCGTGGTGAAGGCGCAGAAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10385R-3.in silico     361 GCCAAGGACAAGGAGCTGGACGACCAAAGCGCTAAGATGAGCGTGGTGAAGGCGCAGAAT 420


10385R-3.IR_full       421 GAGGAATTAAAGCAGGCCGTTGCTCAGTTGGAGGCCGCCAACCAGGAACTATGCAAACAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10385R-3.in silico     421 GAGGAATTAAAGCAGGCCGTTGCTCAGTTGGAGGCCGCCAACCAGGAACTATGCAAACAG 480


10385R-3.IR_full       481 CTGCGGCGAAAGAACCAGCGAA 502
                           ||||||||||||||||||||||
10385R-3.in silico     481 CTGCGGCGAAAGAACCAGCGAA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057548.3  CG10385-RA (msl-1), mRNA 
0   NM_132052.2  CG12728-RA (CG12728), mRNA 
0   NM_164503.1  CG16987-RB, transcript variant B (Alp23B), mRNA 
0   NM_078737.2  CG16987-RA, transcript variant A (Alp23B), mRNA 
0   NM_167055.1  CG32756-RA (CG32756), mRNA 
0   NM_079436.1  CG32756-RA (CG32756), mRNA, small, or homeotic discs 1 CG8887-RA (ash1), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_057432.2  CG2762-RA (ush), mRNA 
0   NM_169761.1  CG31190-RA, transcript variant A (CG31190), mRNA 
0   NM_206504.1  CG31190-RB, transcript variant B (CG31190), mRNA 
0   NM_079398.2  CG7930-RA, transcript variant A (TpnC73F), mRNA 
0   NM_168715.1  CG7930-RB, transcript variant B (TpnC73F), mRNA 
0   NM_058126.3  CG10149-RB, transcript variant B (Rpn6), mRNA 
0   NM_001038786.1  CG33995-RB, transcript variant B (CG33995), mRNA 
0   NM_142132.2  CG3563-RA, transcript variant A (CG3563), mRNA 
0   NM_206488.1  CG3563-RB, transcript variant B (CG3563), mRNA 
0   NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
0   NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
0   NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
0   NM_140284.1  CG6793-RA (CG6793), mRNA 
0   NM_143706.2  CG10622-RA, transcript variant A (Sucb), mRNA 
0   NM_168122.1  CG10622-RB, transcript variant B (Sucb), mRNA 
0   NM_137125.2  CG12869-RA (CG12869), mRNA 
0   NM_142552.2  CG6255-RA (CG6255), mRNA 
0   NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_168353.1  CG32048-RB, transcript variant B (CG32048), mRNA 
0   NM_168352.1  CG32048-RA, transcript variant A (CG32048), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.