National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10376R-1 
 Symbol CG10376  Full Name CG10376 
 CG No CG10376  Old CG No CG10376 
 Synonyms PP2C, CG10376 
 Accession No (Link to NCBI) NM_136055.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTCGTCAGATGCGATTCCC 
 Primer Seq. 3'
aatctagaggtaccTTCTTTACAGCGGCAGATGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTCGTCAG ATGCGATTCC CGCATCGGAA TGTGCGCACC TGATGGAATT CAAGCGATTT 
0061 CTGGTCAGCA CGGCGNAGAA GGCAGCAGCC NTAAGCGAGG GAGGTGGTCA GCCGGAGTTG 
0121 TGTAACTCGT ACGGGCCAAT GAAGACATAC AAAGTGTCCG GCGAGGAGCG TCATGCCGAA 
0181 TTGGTCTCAG CTATTTGGAA ACAACTGGAG ACTCGAGGAT GTCCNGGCGC AGTTCCGGAT 
0241 TAAGCTACTC CATCGAAGCA CACAGCAGCT GGAGCAGGAT CTGTNCTTTG CCAAGGAGTG 
0301 TGAAGTCACC GTGGAGGGGT CCGCCGCAGT ACGATCTTCT CAAGCTGCAG AAGTTCGTGG 
0361 CCAGTGAGTT TGAGAAGTAC ATCCTAAAAC TCACCGACAA CTCGGAGGTG GATCGCCTCA 
0421 AGNNCTTCGC TGATGAgGCG GCGCCGGAAA ACTGCGAGTG CCACCAGCAG AAAGAACCCC 
0481 TGCACACATC TGCCGCTGTA AAGAA 
 in silico PCR Fragment
0001 ATGTCGTCAG ATGCGATTCC CGCATCGGAA TGTGCGCACC TGATGGAATT CAAGCGATTT 
0061 CTGGTCAGCA CGGCGGAGAA GGCAGCAGCC GTAAGCGA-G GAGGTGGTCA GCCGGAGTTG 
0121 TGTAACTCGT AC-GGCCAAT G-AGACATAC AAAGTGTCCG GCGAGGAGCG TCATGCCGAA 
0181 TTGGTCTCAG CTATTTGGAA ACAACTGGAG ACTCGAGGAT GTCC-GGCGC AGTTCCGGAT 
0241 TAAGCTACTC CATCGAAGCA CACAGCAGCT GGAGCAGGAT CTGTGCTTTG CCAAGGAGTG 
0301 TGAAGTCACC GTGGA-GGGT CCGCCGCAGT ACGATCTTCT CAAGCTGCAG AAGTTCGTGG 
0361 CCAGTGAGTT TGAGAAGTAC ATCCTAAAAC TCACCGACAA CTCGGAGGTG GATCGCCTCA 
0421 AGGACTTCGC TGATGAGGCG GCGCCGGAAA ACTGCGAGTG CCACCAGCAG AAAGAACCCC 
0481 TGCACACATC TGCCGCTGTA AAGAA 
 Assemble Data

10376R-1.IR_full       1   ATGTCGTCAGATGCGATTCCCGCATCGGAATGTGCGCACCTGATGGAATTCAAGCGATTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10376R-1.in silico     1   ATGTCGTCAGATGCGATTCCCGCATCGGAATGTGCGCACCTGATGGAATTCAAGCGATTT 60


10376R-1.IR_full       61  CTGGTCAGCACGGCGNAGAAGGCAGCAGCCNTAAGCGAGGGAGGTGGTCAGCCGGAGTTG 120
                           ||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||
10376R-1.in silico     61  CTGGTCAGCACGGCGGAGAAGGCAGCAGCCGTAAGCGA-GGAGGTGGTCAGCCGGAGTTG 120


10376R-1.IR_full       121 TGTAACTCGTACGGGCCAATGAAGACATACAAAGTGTCCGGCGAGGAGCGTCATGCCGAA 180
                           |||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||
10376R-1.in silico     121 TGTAACTCGTAC-GGCCAATG-AGACATACAAAGTGTCCGGCGAGGAGCGTCATGCCGAA 180


10376R-1.IR_full       181 TTGGTCTCAGCTATTTGGAAACAACTGGAGACTCGAGGATGTCCNGGCGCAGTTCCGGAT 240
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
10376R-1.in silico     181 TTGGTCTCAGCTATTTGGAAACAACTGGAGACTCGAGGATGTCC-GGCGCAGTTCCGGAT 240


10376R-1.IR_full       241 TAAGCTACTCCATCGAAGCACACAGCAGCTGGAGCAGGATCTGTNCTTTGCCAAGGAGTG 300
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
10376R-1.in silico     241 TAAGCTACTCCATCGAAGCACACAGCAGCTGGAGCAGGATCTGTGCTTTGCCAAGGAGTG 300


10376R-1.IR_full       301 TGAAGTCACCGTGGAGGGGTCCGCCGCAGTACGATCTTCTCAAGCTGCAGAAGTTCGTGG 360
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
10376R-1.in silico     301 TGAAGTCACCGTGGA-GGGTCCGCCGCAGTACGATCTTCTCAAGCTGCAGAAGTTCGTGG 360


10376R-1.IR_full       361 CCAGTGAGTTTGAGAAGTACATCCTAAAACTCACCGACAACTCGGAGGTGGATCGCCTCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10376R-1.in silico     361 CCAGTGAGTTTGAGAAGTACATCCTAAAACTCACCGACAACTCGGAGGTGGATCGCCTCA 420


10376R-1.IR_full       421 AGNNCTTCGCTGATGAGGCGGCGCCGGAAAACTGCGAGTGCCACCAGCAGAAAGAACCCC 480
                           ||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10376R-1.in silico     421 AGGACTTCGCTGATGAGGCGGCGCCGGAAAACTGCGAGTGCCACCAGCAGAAAGAACCCC 480


10376R-1.IR_full       481 TGCACACATCTGCCGCTGTAAAGAA 505
                           |||||||||||||||||||||||||
10376R-1.in silico     481 TGCACACATCTGCCGCTGTAAAGAA 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136055.2  CG10376-RA (CG10376), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_140344.1  CG10967-RA (Atg1), mRNA 
0   NM_133049.1  CG5988-RA (upd2), mRNA 
0   NM_142575.1  CG11453-RA (CG11453), mRNA 
0   NM_136089.2  CG17492-RA (mib2), mRNA 
0   NM_165599.1  CG30376-RA (CG30376), mRNA 
0   NM_168171.1  CG32397-RA (CG32397), mRNA 
0   NM_143436.1  CG2006-RA (CG2006), mRNA 
0   NM_167842.1  CG13900-RA, transcript variant A (CG13900), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_135363.2  CG7806-RA (CG7806), mRNA 
0   NM_166950.1  CG2694-RC, transcript variant C (CG2694), mRNA 
0   NM_166949.1  CG2694-RA, transcript variant A (CG2694), mRNA 
0   NM_130668.2  CG2694-RB, transcript variant B (CG2694), mRNA 
0   NM_166484.1  CG17952-RC, transcript variant C (LBR), mRNA 
0   NM_137764.2  CG17952-RA, transcript variant A (LBR), mRNA 
0   NM_166485.1  CG17952-RB, transcript variant B (LBR), mRNA 
0   NM_142935.1  CG13601-RA (CG13601), mRNA 
0   NM_170035.1  CG4917-RB, transcript variant B (wfs1), mRNA 
0   NM_142822.1  CG4917-RA, transcript variant A (wfs1), mRNA 
0   NM_167884.1  CG1009-RE, transcript variant E (Psa), mRNA 
0   NM_167883.1  CG1009-RC, transcript variant C (Psa), mRNA 
0   NM_167887.1  CG1009-RF, transcript variant F (Psa), mRNA 
0   NM_167885.1  CG1009-RA, transcript variant A (Psa), mRNA 
0   NM_139360.2  CG1009-RB, transcript variant B (Psa), mRNA 
0   NM_167886.1  CG1009-RD, transcript variant D (Psa), mRNA 
0   NM_079002.2  CG3905-RA (Su(z)2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.