National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10373R-3 
 Symbol CG10373  Full Name CG10373 
 CG No CG10373  Old CG No CG10373 
 Synonyms CG10373 
 Accession No (Link to NCBI) NM_136057.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACAACGCCCTCCACTTCC 
 Primer Seq. 3'
aatctagaggtaccGCGTGGATGAAGGTCAGCGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGACAACGC CCTCCACTTC CGTgGGCGAT GCAGCCGCCG CCTTGTCCGG CAATCTTCAG 
0061 TTGCCGCCTC TGCGAACCCT CGATGACTTC ATCCTGGGAT CGGCCCGATT CCAACTGCCC 
0121 AATCTCAAGG ATTTTGAGAA GTGGGGCAAT CGGGTGGTGA AGAACCTGCT CTATTACCAA 
0181 ACAAACTACT TTTTGCTCTT CATTACCATC TACGTTTTGA TGATTTTCTT CAATCCTTCA 
0241 AAGATTATTA CTGGTCTGCT GGTGCAGGCT TTGATCATAG GCGTTATCTG GCAGTTCTTC 
0301 AGCGGAAAGT CGAAGAAGAA CTTCATCGCC AGTCGTCTGA CTGGTGGAAA TGCCAATGCA 
0361 GCAGAGCAGA ATGCCCAACA GAAATGGTAC ATACTGGCTG GAGCTCTGCT CGGAGGTTAT 
0421 CTTCTTCTGC ATCTGCTGAG CGCAGTGCTT TTGACGATTT TCACCGTGTT GCTACCTATT 
0481 TCGCTGACCT TCATCCACGC  
 in silico PCR Fragment
0001 ATGACAACGC CCTCCACTTC CGTGGGCGAT GCAGCCGCCG CCTTGTCCGG CAATCTTCAG 
0061 TTGCCGCCTC TGCGAACCCT CGATGACTTC ATCCTGGGAT CGGCCCGATT CCAACTGCCC 
0121 AATCTCAAGG ATTTTGAGAA GTGGGGCAAT CGGGTGGTGA AGAACCTGCT CTATTACCAA 
0181 ACAAACTACT TTTTGCTCTT CATTACCATC TACGTTTTGA TGATTTTCTT CAATCCTTCA 
0241 AAGATTATTA CTGGTCTGCT GGTGCAGGCT TTGATCATAG GCGTTATCTG GCAGTTCTTC 
0301 AGCGGAAAGT CGAAGAAGAA CTTCATCGCC AGTCGTCTGA CTGGTGGAAA TGCCAATGCA 
0361 GCAGAGCAGA ATGCCCAACA GAAATGGTAC ATACTGGCTG GAGCTCTGCT CGGAGGTTAT 
0421 CTTCTTCTGC ATCTGCTGAG CGCAGTGCTT TTGACGATTT TCACCGTGTT GCTACCTATT 
0481 TCGCTGACCT TCATCCACGC  
 Assemble Data

10373R-3.IR_full       1   ATGACAACGCCCTCCACTTCCGTGGGCGATGCAGCCGCCGCCTTGTCCGGCAATCTTCAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     1   ATGACAACGCCCTCCACTTCCGTGGGCGATGCAGCCGCCGCCTTGTCCGGCAATCTTCAG 60


10373R-3.IR_full       61  TTGCCGCCTCTGCGAACCCTCGATGACTTCATCCTGGGATCGGCCCGATTCCAACTGCCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     61  TTGCCGCCTCTGCGAACCCTCGATGACTTCATCCTGGGATCGGCCCGATTCCAACTGCCC 120


10373R-3.IR_full       121 AATCTCAAGGATTTTGAGAAGTGGGGCAATCGGGTGGTGAAGAACCTGCTCTATTACCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     121 AATCTCAAGGATTTTGAGAAGTGGGGCAATCGGGTGGTGAAGAACCTGCTCTATTACCAA 180


10373R-3.IR_full       181 ACAAACTACTTTTTGCTCTTCATTACCATCTACGTTTTGATGATTTTCTTCAATCCTTCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     181 ACAAACTACTTTTTGCTCTTCATTACCATCTACGTTTTGATGATTTTCTTCAATCCTTCA 240


10373R-3.IR_full       241 AAGATTATTACTGGTCTGCTGGTGCAGGCTTTGATCATAGGCGTTATCTGGCAGTTCTTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     241 AAGATTATTACTGGTCTGCTGGTGCAGGCTTTGATCATAGGCGTTATCTGGCAGTTCTTC 300


10373R-3.IR_full       301 AGCGGAAAGTCGAAGAAGAACTTCATCGCCAGTCGTCTGACTGGTGGAAATGCCAATGCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     301 AGCGGAAAGTCGAAGAAGAACTTCATCGCCAGTCGTCTGACTGGTGGAAATGCCAATGCA 360


10373R-3.IR_full       361 GCAGAGCAGAATGCCCAACAGAAATGGTACATACTGGCTGGAGCTCTGCTCGGAGGTTAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     361 GCAGAGCAGAATGCCCAACAGAAATGGTACATACTGGCTGGAGCTCTGCTCGGAGGTTAT 420


10373R-3.IR_full       421 CTTCTTCTGCATCTGCTGAGCGCAGTGCTTTTGACGATTTTCACCGTGTTGCTACCTATT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10373R-3.in silico     421 CTTCTTCTGCATCTGCTGAGCGCAGTGCTTTTGACGATTTTCACCGTGTTGCTACCTATT 480


10373R-3.IR_full       481 TCGCTGACCTTCATCCACGC 500
                           ||||||||||||||||||||
10373R-3.in silico     481 TCGCTGACCTTCATCCACGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136057.1  CG10373-RA (CG10373), mRNA 
0.2   NM_058118.3  CG18783-RB, transcript variant B (Kr-h1), mRNA 
0   NM_167843.1  CG13887-RC, transcript variant C (CG13887), mRNA 
0   NM_138218.2  CG13887-RB, transcript variant B (CG13887), mRNA 
0   NM_135824.2  CG9014-RA (CG9014), mRNA 
0   NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
0   NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_135952.1  CG5953-RA, transcript variant A (CG5953), mRNA 
0   NM_165165.1  CG5953-RB, transcript variant B (CG5953), mRNA 
0   NM_130548.2  CG11418-RA, transcript variant A (CG11418), mRNA 
0   NM_135541.1  CG13141-RA (CG13141), mRNA 
0   NM_142828.1  CG13842-RA (CG13842), mRNA 
0   NM_143384.1  CG14529-RA (CG14529), mRNA 
0   NM_135416.1  CG9525-RA (CG9525), mRNA 
0   24  18  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_057527.3  CG6122-RA (piwi), mRNA 
0   NM_137073.2  CG13349-RA, transcript variant A (CG13349), mRNA 
0   NM_166025.1  CG13349-RB, transcript variant B (CG13349), mRNA 
0   NM_135978.1  CG12288-RA (CG12288), mRNA 
0   NM_132959.2  CG8949-RA (CG8949), mRNA 
0   NM_142823.1  CG6958-RA (CG6958), mRNA 
0   NM_206540.1  CG33334-RA (CG33334), mRNA 
0   NM_135067.1  CG6081-RA (Cyp28d2), mRNA 
0   NM_078783.2  CG7068-RA (TepIII), mRNA 
0   NM_078601.2  CG9533-RA (rut), mRNA 
0   NM_166870.1  CG32859-RA (eIF4E-7), mRNA 
0   NM_132199.2  CG2206-RA, transcript variant A (l(1)G0193), mRNA 
0   NM_142319.3  CG10349-RA (CG10349), mRNA 
0   NM_168441.1  CG32071-RA (CG32071), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.