National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10372R-1 
 Symbol Faf  Full Name Fas-associated factor 
 CG No CG10372  Old CG No CG10372 
 Synonyms GT#49, FFAF, CG10372, Faf 
 Accession No (Link to NCBI) NM_058040.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGATGGACTGACCAACGAA 
 Primer Seq. 3'
aatctagaggtaccGCATATGTGCCCTGATAGAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGATGGAC TGACCAACGA ACAGACGGAG AAGGTCCTCC AGTTCCAGGA TCTCACCGGC 
0061 ATCGAGGATA TGAACGTCTG CCGCGACGTC CTAATCAGAC ACCAATGGGA TCTCGAGGTG 
0121 GCCTTCCAGG AGCAGCTAAA TATCCGCGAG GGGCGTCCGA CCATGTTCGC CGCCTCTACA 
0181 GATGTCCGAG CGCCCGCTGT CCTTAACGAT CGCTTCCTGC AGCAGGTGTT TTCCGCCAAC 
0241 ATGCCTGGCG GAAGGACGGT TAGCCGGGTG CCCAGTGGCC CCGTTCCCCG CAGCTTCACC 
0301 GGCATCATTG GATATGTGAT TAACTTCGTG TTTCAGTACT TCTACTCCAC GCTGACGAGC 
0361 ATCGTCAGTG CGTTTGTGAA CCTGGGCGGA GGAAACGAAG CCCGCNTTGG TGACAGATCC 
0421 ACTGGGGGAT GTGATGAAGT TTATTAGGGA ATACTACGAA AGGTATCCCG AGCACCCGGT 
0481 CTTCTATCAG GGCACATATG C 
 in silico PCR Fragment
0001 GCTGATGGAC TGACCAACGA ACAGACGGAG AAGGTCCTCC AGTTCCAGGA TCTCACCGGC 
0061 ATCGAGGATA TGAACGTCTG CCGCGACGTC CTAATCAGAC ACCAATGGGA TCTCGAGGTG 
0121 GCCTTCCAGG AGCAGCTAAA TATCCGCGAG GGGCGTCCGA CCATGTTCGC CGCCTCTACA 
0181 GATGTCCGAG CGCCCGCTGT CCTTAACGAT CGCTTCCTGC AGCAGGTGTT TTCCGCCAAC 
0241 ATGCCTGGCG GAAGGACGGT TAGCCGGGTG CCCAGTGGCC CCGTTCCCCG CAGCTTCACC 
0301 GGCATCATTG GATATGTGAT TAACTTCGTG TTTCAGTACT TCTACTCCAC GCTGACGAGC 
0361 ATCGTCAGTG CGTTTGTGAA CCTGGGCGGA GGAAACGAAG CCCGC-TTGG TGACAGATCC 
0421 ACTGGGGGAT GTGATGAAGT TTATTAGGGA ATACTACGAA AGGTATCCCG AGCACCCGGT 
0481 CTTCTATCAG GGCACATATG C 
 Assemble Data

10372R-1.IR_full       1   GCTGATGGACTGACCAACGAACAGACGGAGAAGGTCCTCCAGTTCCAGGATCTCACCGGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10372R-1.in silico     1   GCTGATGGACTGACCAACGAACAGACGGAGAAGGTCCTCCAGTTCCAGGATCTCACCGGC 60


10372R-1.IR_full       61  ATCGAGGATATGAACGTCTGCCGCGACGTCCTAATCAGACACCAATGGGATCTCGAGGTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10372R-1.in silico     61  ATCGAGGATATGAACGTCTGCCGCGACGTCCTAATCAGACACCAATGGGATCTCGAGGTG 120


10372R-1.IR_full       121 GCCTTCCAGGAGCAGCTAAATATCCGCGAGGGGCGTCCGACCATGTTCGCCGCCTCTACA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10372R-1.in silico     121 GCCTTCCAGGAGCAGCTAAATATCCGCGAGGGGCGTCCGACCATGTTCGCCGCCTCTACA 180


10372R-1.IR_full       181 GATGTCCGAGCGCCCGCTGTCCTTAACGATCGCTTCCTGCAGCAGGTGTTTTCCGCCAAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10372R-1.in silico     181 GATGTCCGAGCGCCCGCTGTCCTTAACGATCGCTTCCTGCAGCAGGTGTTTTCCGCCAAC 240


10372R-1.IR_full       241 ATGCCTGGCGGAAGGACGGTTAGCCGGGTGCCCAGTGGCCCCGTTCCCCGCAGCTTCACC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10372R-1.in silico     241 ATGCCTGGCGGAAGGACGGTTAGCCGGGTGCCCAGTGGCCCCGTTCCCCGCAGCTTCACC 300


10372R-1.IR_full       301 GGCATCATTGGATATGTGATTAACTTCGTGTTTCAGTACTTCTACTCCACGCTGACGAGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10372R-1.in silico     301 GGCATCATTGGATATGTGATTAACTTCGTGTTTCAGTACTTCTACTCCACGCTGACGAGC 360


10372R-1.IR_full       361 ATCGTCAGTGCGTTTGTGAACCTGGGCGGAGGAAACGAAGCCCGCNTTGGTGACAGATCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
10372R-1.in silico     361 ATCGTCAGTGCGTTTGTGAACCTGGGCGGAGGAAACGAAGCCCGC-TTGGTGACAGATCC 420


10372R-1.IR_full       421 ACTGGGGGATGTGATGAAGTTTATTAGGGAATACTACGAAAGGTATCCCGAGCACCCGGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10372R-1.in silico     421 ACTGGGGGATGTGATGAAGTTTATTAGGGAATACTACGAAAGGTATCCCGAGCACCCGGT 480


10372R-1.IR_full       481 CTTCTATCAGGGCACATATGC 501
                           |||||||||||||||||||||
10372R-1.in silico     481 CTTCTATCAGGGCACATATGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058040.3  CG10372-RA (Faf), mRNA 
0.2   NM_078720.2  CG11840-RA (Spp), mRNA 
0   NM_134943.1  CG3213-RA (CG3213), mRNA 
0   NM_132302.3  CG7055-RA (dalao), mRNA 
0   NM_170534.1  CG1462-RB, transcript variant B (Aph-4), mRNA 
0   NM_079862.2  CG1462-RA, transcript variant A (Aph-4), mRNA 
0   NM_078823.2  CG16928-RA (mre11), mRNA 
0   NM_132803.1  CG6308-RA (CG6308), mRNA 
0   NM_164696.1  CG31635-RA (CG31635), mRNA 
0   NM_134655.1  CG11620-RA (CG11620), mRNA 
0   NM_135199.2  CG31637-RA (CG31637), mRNA 
0   NM_170576.1  CG1945-RC, transcript variant C (faf), mRNA 
0   NM_079873.3  CG1945-RA, transcript variant A (faf), mRNA 
0   NM_142248.2  CG31183-RA (CG31183), mRNA 
0   NM_080018.1  CG6890-RA (Tollo), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_166301.1  CG5469-RB, transcript variant B (Gint3), mRNA 
0   NM_166302.1  CG5469-RC, transcript variant C (Gint3), mRNA 
0   NM_137512.2  CG5469-RD, transcript variant D (Gint3), mRNA 
0   NM_079203.2  CG11348-RA, transcript variant A (nAcRbeta-64B), mRNA 
0   NM_143605.2  CG11339-RA (CG11339), mRNA 
0   NM_170421.1  CG15506-RB, transcript variant B (CG15506), mRNA 
0   NM_143457.1  CG15506-RA, transcript variant A (CG15506), mRNA 
0   NM_140637.2  CG4573-RA (CG4573), mRNA 
0   NM_167909.2  CG7971-RC, transcript variant C (CG7971), mRNA 
0   NM_135777.1  CG16813-RA (CG16813), mRNA 
0   NM_001031932.1  CG7971-RD, transcript variant D (CG7971), mRNA 
0   NM_139385.3  CG7971-RA, transcript variant A (CG7971), mRNA 
0   NM_078517.2  CG2175-RA, transcript variant A (dec-1), mRNA 
0   NM_167133.1  CG2175-RC, transcript variant C (dec-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.