National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10366R-3 
 Symbol CG10366  Full Name CG10366 
 CG No CG10366  Old CG No CG10366 
 Synonyms CG10366 
 Accession No (Link to NCBI) NM_136151.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGGTGGAGATGCACGCTGCTCCGGCGGCTCCCCATGTCGATCGAAATCCCAGCAGCGACT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGCGACAGTGGTGTCGCCTGTGCGCCAAGGACGACGTGCAAGGCAACTTGAATGTGTTCC 120

                           ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||| silico     121 TCAAGAACGAGGATTCCGGCGAGGCAGCCTCCATGGA-ACTGGCCACCGCCATTGGCAAG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TACTTCTGGGTGAATATAACTCGAGGTGAAGAGCTGCCGGAGACGATATGCAGTGAGTGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CTGTCGCTGGTCACCTCGCTGGTGAATTTCTCGGAACGGATTACCCGCGTGCAGAAGCTT 300

                           |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     301 TACTGCATCCTGCAGAGCACGCCCAGCCAGGAGAGGCCAAAT-CTCCACGAGCTGCGCTC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAATTTGGTTTGCTGGACGAGGAGACGCAGACTGAGGTGCACTATGTGGACAAGAAGCC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAAGTTGGATGAACAGCTCGAGTTTCTGCCAGAGGAGTCGCCTTACGAGCTGGCAAACCC 480

10366R-3.IR_full       481 ACTAACGCCAGAGGAAAATGCAG 503
                           |||||||||||||||||| |||| silico     481 ACTAACGCCAGAGGAAAA-GCAG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136151.1  CG10366-RA (CG10366), mRNA 
2.07   10  10  NM_136107.2  CG17568-RA (CG17568), mRNA 
0   20  NM_141726.1  CG6254-RA (CG6254), mRNA 
0   NM_132957.1  CG9059-RB, transcript variant B (CG9059), mRNA 
0   NM_167553.1  CG9059-RA, transcript variant A (CG9059), mRNA 
0   11  NM_080191.2  CG4148-RA (wek), mRNA 
0   NM_175991.1  CG10595-RA, transcript variant A (d), mRNA 
0   NM_205940.1  CG10595-RB, transcript variant B (d), mRNA 
0   NM_078805.3  CG5838-RA (Dref), mRNA 
0   11  NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_169185.1  CG31513-RA (CG31513), mRNA 
0   NM_169197.2  CG31187-RA (CG31187), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   NM_167239.2  CG32677-RA (CG32677), mRNA 
0   NM_141568.2  CG9797-RA (CG9797), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_079337.2  CG9206-RA (Gl), mRNA 
0   NM_078922.2  CG4486-RA (Cyp9b2), mRNA 
0   13  NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   13  NM_206150.1  CG30460-RB, transcript variant B (CG30460), mRNA 
0   13  NM_206149.1  CG30460-RA, transcript variant A (CG30460), mRNA 
0   NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_206148.1  CG30460-RD, transcript variant D (CG30460), mRNA 
0   NM_078681.2  CG32540-RA (CCKLR-17D3), mRNA 
0   NM_057981.3  CG4063-RA (ebi), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_165571.1  CG1877-RC, transcript variant C (lin19), mRNA 
0   NM_165570.1  CG1877-RB, transcript variant B (lin19), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.