National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10364R-1 
 Symbol msb1l  Full Name msb1l 
 CG No CG10364  Old CG No CG10364 
 Synonyms msh1l, CG10364, msb1l 
 Accession No (Link to NCBI) NM_136147.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGAATATCTGCCGGATACGC 
 Primer Seq. 3'
aatctagaggtaccCTGATCATAGGGCAGTGAAAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGAATATCT GCCGGATACG CCGACACTAA NCAAAATGCG CCTGGCCAGC GAAAAGCGAN 
0061 GAACAAATGG AAATGACGAC GCCGAATCGA GAGCAAAACA ACGCTTTGCT CGATCCTCGA 
0121 TCACCAAATG GCTGCCGCAC GCCNTTTAAC CTTCTTGCAG GCGTCAAAAC CTCGCGTTGA 
0181 GGAGGAGGAG CAGCATGTGA CCACCAGTGA AAATGCCTTC TCCATGCTGC GAAAACGTTT 
0241 GCTCAAGGGC TTCTCCCTGA ACGATCCTCG CTCTCCTCAG CTGAATCGCA CTCCACTGGT 
0301 CCTCGATGAG GTTCGTTCGC TTAATATGGA TGACACATTC GCCGATCTCT TCGTGGACAC 
0361 CAAGGTGGGT ACAGCACAGA GAGNAGTGCC TGCATCACCG CCCCAAGTGG ATTTAGAGGA 
0421 GAGCTGCGAT AGCTTCgGCA CACCGCCGNC TNCTGCACAC AACAATATTT CCCTGGAGAT 
0481 TGTTTCACTG CCCTATGATC AG 
 in silico PCR Fragment
0001 GTGAATATCT GCCGGATACG CCGACACTAA ACAAAATGCG CCTGGCCAGC GAAAAGCGA- 
0061 GAACAAATGG AAATGACGAC GCCGAATCGA GAGCAAAACA ACGCTTTGCT CGATCCTCGA 
0121 TCACCAAATG GCTGCCGCAC GCC-TTTAAC CTTCTTGCAG GCGTCAAAAC CTCGCGTTGA 
0181 GGAGGAGGAG CAGCATGTGA CCACCAGTGA AAATGCCTTC TCCATGCTGC GAAAACGTTT 
0241 GCTCAAGGGC TTCTCCCTGA ACGATCCTCG CTCTCCTCAG CTGAATCGCA CTCCACTGGT 
0301 CCTCGATGAG GTTCGTTCGC TTAATATGGA TGACACATTC GCCGATCTCT TCGTGGACAC 
0361 CAGGGTGGGT ACAGCACAGA GAGCAGTGCC TGCATCACCG CCCCAAGTGG ATTTAGAGGA 
0421 GAGCTGCGAT AGCTTCGGCA CACCGCCGTC TGCTGCACAC AACAATATTT CCCTGGAGAT 
0481 TGTTTCACTG CCCTATGATC AG 
 Assemble Data

10364R-1.IR_full        1   TGAATATCTGCCGGATACGCCGACACTAANCAAAATGCGCCTGGCCAGCGAAAAGCGAN 59
                            ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| 
10364R-1.in silico      1   TGAATATCTGCCGGATACGCCGACACTAAACAAAATGCGCCTGGCCAGCGAAAAGCGA- 59


10364R-1.IR_full       61  GAACAAATGGAAATGACGACGCCGAATCGAGAGCAAAACAACGCTTTGCTCGATCCTCGA 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10364R-1.in silico     61  GAACAAATGGAAATGACGACGCCGAATCGAGAGCAAAACAACGCTTTGCTCGATCCTCGA 119


10364R-1.IR_full       121 TCACCAAATGGCTGCCGCACGCCNTTTAACCTTCTTGCAGGCGTCAAAACCTCGCGTTGA 179
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
10364R-1.in silico     121 TCACCAAATGGCTGCCGCACGCC-TTTAACCTTCTTGCAGGCGTCAAAACCTCGCGTTGA 179


10364R-1.IR_full       181 GGAGGAGGAGCAGCATGTGACCACCAGTGAAAATGCCTTCTCCATGCTGCGAAAACGTTT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10364R-1.in silico     181 GGAGGAGGAGCAGCATGTGACCACCAGTGAAAATGCCTTCTCCATGCTGCGAAAACGTTT 239


10364R-1.IR_full       241 GCTCAAGGGCTTCTCCCTGAACGATCCTCGCTCTCCTCAGCTGAATCGCACTCCACTGGT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10364R-1.in silico     241 GCTCAAGGGCTTCTCCCTGAACGATCCTCGCTCTCCTCAGCTGAATCGCACTCCACTGGT 299


10364R-1.IR_full       301 CCTCGATGAGGTTCGTTCGCTTAATATGGATGACACATTCGCCGATCTCTTCGTGGACAC 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10364R-1.in silico     301 CCTCGATGAGGTTCGTTCGCTTAATATGGATGACACATTCGCCGATCTCTTCGTGGACAC 359


10364R-1.IR_full       361 CAAGGTGGGTACAGCACAGAGAGNAGTGCCTGCATCACCGCCCCAAGTGGATTTAGAGGA 419
                           || |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
10364R-1.in silico     361 CAGGGTGGGTACAGCACAGAGAGCAGTGCCTGCATCACCGCCCCAAGTGGATTTAGAGGA 419


10364R-1.IR_full       421 GAGCTGCGATAGCTTCGGCACACCGCCGNCTNCTGCACACAACAATATTTCCCTGGAGAT 479
                           |||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||
10364R-1.in silico     421 GAGCTGCGATAGCTTCGGCACACCGCCGTCTGCTGCACACAACAATATTTCCCTGGAGAT 479


10364R-1.IR_full       481 TGTTTCACTGCCCTATGATCAG 501
                           ||||||||||||||||||||||
10364R-1.in silico     481 TGTTTCACTGCCCTATGATCAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136147.2  CG10364-RA (msb1l), mRNA 
0   NM_001032245.1  CG13344-RB, transcript variant B (CG13344), mRNA 
0   NM_137071.3  CG13344-RA, transcript variant A (CG13344), mRNA 
0   12  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   12  NM_143344.2  CG5520-RA (Gp93), mRNA 
0   NM_138121.2  CG16932-RA, transcript variant A (Eps-15), mRNA 
0   NM_166686.1  CG16932-RC, transcript variant C (Eps-15), mRNA 
0   NM_166687.1  CG16932-RB, transcript variant B (Eps-15), mRNA 
0   15  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   15  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_132642.2  CG15744-RA (CG15744), mRNA 
0   NM_140674.2  CG11915-RA (CG11915), mRNA 
0   NM_079386.1  CG4143-RA, transcript variant A (mbf1), mRNA 
0   NM_168673.1  CG4143-RB, transcript variant B (mbf1), mRNA 
0   NM_166661.1  CG30179-RA (CG30179), mRNA 
0   NM_170178.1  CG31381-RA (CG31381), mRNA 
0   NM_133143.1  CG8002-RA (rictor), mRNA 
0   NM_079779.2  CG8328-RA (HLHmdelta), mRNA 
0   NM_138179.2  CG12313-RA (CG12313), mRNA 
0   NM_168145.1  CG32412-RA (CG32412), mRNA 
0   NM_140501.2  CG7011-RA (CG7011), mRNA 
0   NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.