National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10348R-5 
 Symbol CG10348  Full Name CG10348 
 CG No CG10348  Old CG No CG10348 
 Synonyms CG10348 
 Accession No (Link to NCBI) NM_136060.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGACGACGTCGGCAACGACA 
 Primer Seq. 3'
aatctagaggtaccGGCAAAACCCCAGCGAACACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGACGACGT CGGCAACGAC AATCTGGGCG GCTGCAGCAC CAACACTCCC ACCAGCAACA 
0061 CCAGACCTTA AATCACCATG CCAAGGGCAA GCGGAGAAGC AGTTTCGATC AGCCGTTGGA 
0121 TCTGCGGTTG GCACACAAGC GGAAAACGGA CCTGGTGGAT CAAGGACCCA TGGAGGATGA 
0181 GAACAGCAAC CTGATCATGT TCGCCAGTGA ACTGGCGGTG GCTCAGCAAA AGGAGAAGGA 
0241 GCTGAACAAC AACCATATCG CAGCATCGCT GGCCGACCTG GGCTTTGATA TGAGCCGCAA 
0301 AATGCTGAGG GCCTTGAGAG AGGGTGGTGC AGGTGGCGGT GGCggaGGAG GAGGAGGAGG 
0361 AGGAGGCGGT GGTGGACCAC CCAACGCACC GCCCTTAACA CCACCGCAAT GTTCGATACC 
0421 TGCCGTACAT CCCACACTCC TAGAAGCCAT GACCAAGAAC NTGCCCTTGC AGTATCGCAA 
0481 TGTGTTCGCT GGGGTTTTGC C 
 in silico PCR Fragment
0001 ACGACGACGT CGGCAACGAC AA-CTGGGCG GCTGCAGCAC CAACACTCCC ACCAGCAACA 
0061 CCAGACCTTA AATCACCATG CCAAGGGCAA GCGGAGAAGC AGTTTCGATC AGCCGTTGGA 
0121 TCTGCGGTTG GCACACAAGC GGAAAACGGA CCTGGTGGAT CAAGGACCCA TGGAGGATGA 
0181 GAACAGCAAC CTGATCATGT TCGCCAGTGA ACTGGCGGTG GCTCAGCAAA AGGAGAAGGA 
0241 GCTGAACAAC AACCATATCG CAGCATCGCT GGCCGACCTG GGCTTTGATA TGAGCCGCAA 
0301 AATGCTGAGG GCCTTGAGAG AGGGTGGTGC AGGTGGCGGT GGCGGAGGAG GAGGAGGAGG 
0361 AGGAGGCGGT GGTGGACCAC CCAACGCACC GCCCTTAACA CCACCGCAAT GTTCGATACC 
0421 TGCCGTACAT CCCACACTCC TAGAAGCCAT GACCAAGAAC TTGCCCTTGC AGTATCGCAA 
0481 TGTGTTCGCT GGGGTTTTGC C 
 Assemble Data

10348R-5.IR_full       1   ACGACGACGTCGGCAACGACAATCTGGGCGGCTGCAGCACCAACACTCCCACCAGCAACA 60
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
10348R-5.in silico     1   ACGACGACGTCGGCAACGACAA-CTGGGCGGCTGCAGCACCAACACTCCCACCAGCAACA 60


10348R-5.IR_full       61  CCAGACCTTAAATCACCATGCCAAGGGCAAGCGGAGAAGCAGTTTCGATCAGCCGTTGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10348R-5.in silico     61  CCAGACCTTAAATCACCATGCCAAGGGCAAGCGGAGAAGCAGTTTCGATCAGCCGTTGGA 120


10348R-5.IR_full       121 TCTGCGGTTGGCACACAAGCGGAAAACGGACCTGGTGGATCAAGGACCCATGGAGGATGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10348R-5.in silico     121 TCTGCGGTTGGCACACAAGCGGAAAACGGACCTGGTGGATCAAGGACCCATGGAGGATGA 180


10348R-5.IR_full       181 GAACAGCAACCTGATCATGTTCGCCAGTGAACTGGCGGTGGCTCAGCAAAAGGAGAAGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10348R-5.in silico     181 GAACAGCAACCTGATCATGTTCGCCAGTGAACTGGCGGTGGCTCAGCAAAAGGAGAAGGA 240


10348R-5.IR_full       241 GCTGAACAACAACCATATCGCAGCATCGCTGGCCGACCTGGGCTTTGATATGAGCCGCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10348R-5.in silico     241 GCTGAACAACAACCATATCGCAGCATCGCTGGCCGACCTGGGCTTTGATATGAGCCGCAA 300


10348R-5.IR_full       301 AATGCTGAGGGCCTTGAGAGAGGGTGGTGCAGGTGGCGGTGGCGGAGGAGGAGGAGGAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10348R-5.in silico     301 AATGCTGAGGGCCTTGAGAGAGGGTGGTGCAGGTGGCGGTGGCGGAGGAGGAGGAGGAGG 360


10348R-5.IR_full       361 AGGAGGCGGTGGTGGACCACCCAACGCACCGCCCTTAACACCACCGCAATGTTCGATACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10348R-5.in silico     361 AGGAGGCGGTGGTGGACCACCCAACGCACCGCCCTTAACACCACCGCAATGTTCGATACC 420


10348R-5.IR_full       421 TGCCGTACATCCCACACTCCTAGAAGCCATGACCAAGAACNTGCCCTTGCAGTATCGCAA 480
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
10348R-5.in silico     421 TGCCGTACATCCCACACTCCTAGAAGCCATGACCAAGAACTTGCCCTTGCAGTATCGCAA 480


10348R-5.IR_full       481 TGTGTTCGCTGGGGTTTTGCC 501
                           |||||||||||||||||||||
10348R-5.in silico     481 TGTGTTCGCTGGGGTTTTGCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.82  486  20  56  50  NM_136060.1  CG10348-RA (CG10348), mRNA 
7.88   38  66  73  90  NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
7.88   38  66  73  90  NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
5.18   25  45  61  81  NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
4.35   21  35  50  73  NM_135975.2  CG31781-RB (CG31781), mRNA 
3.73   18  30  69  105  NM_133114.2  CG32541-RA (CG32541), mRNA 
3.52   17  24  29  43  NM_176374.1  CG4761-RA (knrl), mRNA 
3.11   15  29  44  55  NM_141658.3  CG8301-RA (CG8301), mRNA 
3.11   15  28  48  68  NM_136134.4  CG10186-RA, transcript variant A (CG10186), mRNA 
3.11   15  28  48  68  NM_165306.1  CG10186-RC, transcript variant C (CG10186), mRNA 
3.11   15  26  47  78  NM_167309.1  CG32663-RA (CG32663), mRNA 
2.9   14  35  76  132  NM_133104.2  CG7282-RA (CG7282), mRNA 
2.69   13  48  91  132  NM_167340.1  CG32648-RA (Pde9), mRNA 
2.69   13  41  77  113  NM_167620.2  CG32547-RA (CG32547), mRNA 
2.69   13  33  48  66  NM_057406.3  CG6222-RA (su(s)), mRNA 
2.69   13  31  31  55  NM_143222.1  CG14237-RA (CG14237), mRNA 
2.69   13  29  39  57  NM_135079.4  CG14021-RB, transcript variant B (CG14021), mRNA 
2.69   13  29  39  57  NM_164640.1  CG14021-RA, transcript variant A (CG14021), mRNA 
2.69   13  26  38  53  NM_140288.2  CG6801-RA (l(3)j2D3), mRNA 
2.69   13  26  30  51  NM_135495.2  CG4778-RA (CG4778), mRNA 
2.69   13  24  28  37  NM_138057.1  CG13576-RA (CG13576), mRNA 
2.69   13  23  35  59  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
2.48   12  41  53  85  NM_078516.2  CG12690-RA (CHES-1-like), mRNA 
2.48   12  22  28  39  NM_134510.1  CG12703-RA (CG12703), mRNA 
2.07   10  34  40  53  NM_135939.2  CG4132-RA (pkaap), mRNA 
2.07   10  25  32  43  NM_206764.1  CG4429-RC, transcript variant C (Rbp2), mRNA 
2.07   10  25  32  43  NM_080220.2  CG4429-RA, transcript variant A (Rbp2), mRNA 
2.07   10  25  32  43  NM_167522.2  CG4429-RB, transcript variant B (Rbp2), mRNA 
2.07   10  22  40  71  NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
2.07   10  22  40  71  NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.