National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10346R-1 
 Symbol Grip71  Full Name Grip71 
 CG No CG10346  Old CG No CG10346 
 Synonyms Dgrip71, Dgp71WD, CG10346, Grip71 
 Accession No (Link to NCBI) NM_136058.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACCAAACAGAAGACCAACAC 
 Primer Seq. 3'
aatctagaggtaccTGTTGAGGCTACCGTTCTGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACCAAACAG AAGACCAACA CCTTCACCAT AGATGGCGAC TCTACTCTTG TGCGCTTTCA 
0061 TCCGAGCAAA CGCTTTCATC TGTCGATCGC TTCCTATAAA GGAGCCGTGA CTGTCTATGA 
0121 TGTGCAGGGA ATGCGAAAGA TTTTTCATGC CAGCGAAGCC CACAGTGCTC CCTGCCGGGA 
0181 CATCAGTATG TGCACATCCC AACCGGCACT GCTGGTCAGC GTGGGCTACG ATTGCAAGAT 
0241 AAATATCTTC GACATTCGAC GAAATCGTGC TCAGGCCTCT ACGGATCGCT TGACCTACTC 
0301 GCATCCACTA TCGACGGTGG CGCTGAGTGA ATGTGGCACT TATCTTTGTG CTGGAAACCT 
0361 TAAGGGCGAA TTAATAGCCT ATGATATGAG GAGTACAAAG GCTCCGTTGG CCGTGAGGAG 
0421 TGTACATGAT GCGGCTGTAA CACGTGTAGC CTTTGTGCCC GTGCCAAGTG GGGATAACCA 
0481 GCAGAACGGT AGCCTCAACA  
 in silico PCR Fragment
0001 GACCAAACAG AAGACCAACA CCTTCACCAT AGATGGCGAC TCTACTCTTG TGCGCTTTCA 
0061 TCCGAGCAAA CGCTTTCATC TGTCGATCGC TTCCTATAAA GGAGCCGTGA CTGTCTATGA 
0121 TGTGCAGGGA ATGCGAAAGA TTTTTCATGC CAGCGAAGCC CACAGTGCTC CCTGCCGGGA 
0181 CATCAGTATG TGCACATCCC AACCGGCACT GCTGGTCAGC GTGGGCTACG ATTGCAAGAT 
0241 AAATATCTTC GACATTCGAC GAAATCGTGC TCAGGCCTCT ACGGATCGCT TGACCTACTC 
0301 GCATCCACTA TCGACGGTGG CGCTGAGTGA ATGTGGCACT TATCTTTGTG CTGGAAACCT 
0361 TAAGGGCGAA TTAATAGCCT ATGATATGAG GAGTACAAAG GCTCCGTTGG CCGTGAGGAG 
0421 TGTACATGAT GCGGCTGTAA CACGTGTAGC CTTTGTGCCC GTGCCAAGTG GGGATAACCA 
0481 GCAGAACGGT AGCCTCAACA  
 Assemble Data

10346R-1.IR_full       1   GACCAAACAGAAGACCAACACCTTCACCATAGATGGCGACTCTACTCTTGTGCGCTTTCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     1   GACCAAACAGAAGACCAACACCTTCACCATAGATGGCGACTCTACTCTTGTGCGCTTTCA 60


10346R-1.IR_full       61  TCCGAGCAAACGCTTTCATCTGTCGATCGCTTCCTATAAAGGAGCCGTGACTGTCTATGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     61  TCCGAGCAAACGCTTTCATCTGTCGATCGCTTCCTATAAAGGAGCCGTGACTGTCTATGA 120


10346R-1.IR_full       121 TGTGCAGGGAATGCGAAAGATTTTTCATGCCAGCGAAGCCCACAGTGCTCCCTGCCGGGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     121 TGTGCAGGGAATGCGAAAGATTTTTCATGCCAGCGAAGCCCACAGTGCTCCCTGCCGGGA 180


10346R-1.IR_full       181 CATCAGTATGTGCACATCCCAACCGGCACTGCTGGTCAGCGTGGGCTACGATTGCAAGAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     181 CATCAGTATGTGCACATCCCAACCGGCACTGCTGGTCAGCGTGGGCTACGATTGCAAGAT 240


10346R-1.IR_full       241 AAATATCTTCGACATTCGACGAAATCGTGCTCAGGCCTCTACGGATCGCTTGACCTACTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     241 AAATATCTTCGACATTCGACGAAATCGTGCTCAGGCCTCTACGGATCGCTTGACCTACTC 300


10346R-1.IR_full       301 GCATCCACTATCGACGGTGGCGCTGAGTGAATGTGGCACTTATCTTTGTGCTGGAAACCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     301 GCATCCACTATCGACGGTGGCGCTGAGTGAATGTGGCACTTATCTTTGTGCTGGAAACCT 360


10346R-1.IR_full       361 TAAGGGCGAATTAATAGCCTATGATATGAGGAGTACAAAGGCTCCGTTGGCCGTGAGGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     361 TAAGGGCGAATTAATAGCCTATGATATGAGGAGTACAAAGGCTCCGTTGGCCGTGAGGAG 420


10346R-1.IR_full       421 TGTACATGATGCGGCTGTAACACGTGTAGCCTTTGTGCCCGTGCCAAGTGGGGATAACCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10346R-1.in silico     421 TGTACATGATGCGGCTGTAACACGTGTAGCCTTTGTGCCCGTGCCAAGTGGGGATAACCA 480


10346R-1.IR_full       481 GCAGAACGGTAGCCTCAACA 500
                           ||||||||||||||||||||
10346R-1.in silico     481 GCAGAACGGTAGCCTCAACA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136058.3  CG10346-RA (Grip71), mRNA 
0   NM_079659.2  CG3937-RA, transcript variant A (cher), mRNA 
0   NM_206502.1  CG3937-RD, transcript variant D (cher), mRNA 
0   NM_079924.2  CG18780-RA (MED20), mRNA 
0   NM_167642.1  CG7893-RB, transcript variant B (vav), mRNA 
0   NM_167013.1  CG3000-RB, transcript variant B (rap), mRNA 
0   NM_080113.2  CG3000-RA, transcript variant A (rap), mRNA 
0   NM_141212.3  CG9809-RA, transcript variant A (CG9809), mRNA 
0   NM_168996.3  CG9809-RB, transcript variant B (CG9809), mRNA 
0   NM_168997.3  CG9809-RC, transcript variant C (CG9809), mRNA 
0   NM_135179.2  CG9508-RA (CG9508), mRNA 
0   NM_168641.1  CG5942-RB, transcript variant B (brm), mRNA 
0   NM_080497.4  CG5942-RC, transcript variant C (brm), mRNA 
0   NM_168640.1  CG5942-RD, transcript variant D (brm), mRNA 
0   NM_080498.2  CG5942-RA, transcript variant A (brm), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   11  NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   11  NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   11  NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   11  NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_079149.3  CG17046-RA, transcript variant A (klar), mRNA 
0   NM_001043111.1  CG17046-RB, transcript variant B (klar), mRNA 
0   NM_168924.2  CG32438-RB, transcript variant B (Smc5), mRNA 
0   NM_141077.3  CG32438-RA, transcript variant A (Smc5), mRNA 
0   NM_206419.1  CG32438-RD, transcript variant D (Smc5), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_169364.1  CG17136-RD, transcript variant D (Rbp1), mRNA 
0   NM_167260.1  CG32671-RA (CG32671), mRNA 
0   NM_169432.2  CG31116-RA, transcript variant A (CG31116), mRNA 
0   NM_169431.2  CG31116-RC, transcript variant C (CG31116), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.