National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10343R-1 
 Symbol CG10343  Full Name CG10343 
 CG No CG10343  Old CG No CG10343 
 Synonyms anon-WO0118547.123, CG10343 
 Accession No (Link to NCBI) NM_136056.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGGAAGAACGGGAGGCGTTG 
 Primer Seq. 3'
aatctagaggtaccCCACGTTCCCGGTCTCCTTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGGAAGAAC GGGAGGCGTT GCAGTCAATA TACGAGGGCG ACACGAACTT CAAGGAAATA 
0061 GATAGCGTCA CATTTCAGTA CAAATATGGC GAAGAGGATA ACTACAAGTC GTTCTTGGTC 
0121 GAGCTCAAGT GGGGCGAAAA TTACCCCGAT GAGGCGCCAG CGATCAACAT GAACGCGTTT 
0181 TACAATAGGA ATCTACTGCC AGCTGTCAAG GAAGGGATCC AAACGGCTCT GAGTACGGAA 
0241 GCGGACCAAT GGCTGGGCTG TGGCATGACC TATACCCTGT TCGAATGCCT TAAGGACAAC 
0301 CTGGAGCAAT TGACCGCAGA GCAACCCGAA TCTGCACCCA CGGTGGCGTT AGTGGATGAT 
0361 GGCGTGGGTG CTCTAAAGAT CTCCGATCCC AATGCCGATG CGGAGTCCAA GAAAAAGGAG 
0421 CCCAAGAAGG AGCACCTGAC TAAGGCGCAA AAGCGCCGGC AGNTGGGAGA GAACCGATCA 
0481 CAAAGGAGAC CGGGAACGTG G 
 in silico PCR Fragment
0001 ACGGAAGAAC GGGAGGCGTT GCAGTCAATA TACGAGGGCG ACACGAACTT CAAGGAAATA 
0061 GATAGCGTCA CATTTCAGTA CAAATATGGC GAAGAGGATA ACTACAAGTC GTTCTTGGTC 
0121 GAGCTCAAGT GGGGCGAAAA TTACCCCGAT GAGGCGCCAG CGATCAACAT GAACGCGTTT 
0181 TACAATAGGA ATCTACTGCC AGCTGTCAAG GAAGGGATCC AAACGGCTCT GAGTACGGAA 
0241 GCGGACCAAT GGCTGGGCTG TGGCATGACC TATACCCTGT TCGAATGCCT TAAGGACAAC 
0301 CTGGAGCAAT TGACCGCAGA GCAACCCGAA TCTGCACCCA CGGTGGCGTT AGTGGATGAT 
0361 GGCGTGGGTG CTCTAAAGAT CTCCGATCCC AATGCCGATG CGGAGTCCAA GAAAAAGGAG 
0421 CCCAAGAAGG AGCACCTGAC TAAGGCGCAA AAGCGCCGGC AG-TGGGAGA GAACCGATCA 
0481 CAAAGGAGAC CGGGAACGTG G 
 Assemble Data

10343R-1.IR_full       1   ACGGAAGAACGGGAGGCGTTGCAGTCAATATACGAGGGCGACACGAACTTCAAGGAAATA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10343R-1.in silico     1   ACGGAAGAACGGGAGGCGTTGCAGTCAATATACGAGGGCGACACGAACTTCAAGGAAATA 60


10343R-1.IR_full       61  GATAGCGTCACATTTCAGTACAAATATGGCGAAGAGGATAACTACAAGTCGTTCTTGGTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10343R-1.in silico     61  GATAGCGTCACATTTCAGTACAAATATGGCGAAGAGGATAACTACAAGTCGTTCTTGGTC 120


10343R-1.IR_full       121 GAGCTCAAGTGGGGCGAAAATTACCCCGATGAGGCGCCAGCGATCAACATGAACGCGTTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10343R-1.in silico     121 GAGCTCAAGTGGGGCGAAAATTACCCCGATGAGGCGCCAGCGATCAACATGAACGCGTTT 180


10343R-1.IR_full       181 TACAATAGGAATCTACTGCCAGCTGTCAAGGAAGGGATCCAAACGGCTCTGAGTACGGAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10343R-1.in silico     181 TACAATAGGAATCTACTGCCAGCTGTCAAGGAAGGGATCCAAACGGCTCTGAGTACGGAA 240


10343R-1.IR_full       241 GCGGACCAATGGCTGGGCTGTGGCATGACCTATACCCTGTTCGAATGCCTTAAGGACAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10343R-1.in silico     241 GCGGACCAATGGCTGGGCTGTGGCATGACCTATACCCTGTTCGAATGCCTTAAGGACAAC 300


10343R-1.IR_full       301 CTGGAGCAATTGACCGCAGAGCAACCCGAATCTGCACCCACGGTGGCGTTAGTGGATGAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10343R-1.in silico     301 CTGGAGCAATTGACCGCAGAGCAACCCGAATCTGCACCCACGGTGGCGTTAGTGGATGAT 360


10343R-1.IR_full       361 GGCGTGGGTGCTCTAAAGATCTCCGATCCCAATGCCGATGCGGAGTCCAAGAAAAAGGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10343R-1.in silico     361 GGCGTGGGTGCTCTAAAGATCTCCGATCCCAATGCCGATGCGGAGTCCAAGAAAAAGGAG 420


10343R-1.IR_full       421 CCCAAGAAGGAGCACCTGACTAAGGCGCAAAAGCGCCGGCAGNTGGGAGAGAACCGATCA 480
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
10343R-1.in silico     421 CCCAAGAAGGAGCACCTGACTAAGGCGCAAAAGCGCCGGCAG-TGGGAGAGAACCGATCA 480


10343R-1.IR_full       481 CAAAGGAGACCGGGAACGTGG 501
                           |||||||||||||||||||||
10343R-1.in silico     481 CAAAGGAGACCGGGAACGTGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136056.2  CG10343-RA (CG10343), mRNA 
0   NM_168938.1  CG7383-RB, transcript variant B (eg), mRNA 
0   NM_079482.3  CG7383-RA, transcript variant A (eg), mRNA 
0   NM_136992.2  CG13325-RA (CG13325), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_141784.2  CG6629-RA (CG6629), mRNA 
0   NM_139551.1  CG14961-RA (CG14961), mRNA 
0   NM_001031924.1  CG9130-RB, transcript variant B (CG9130), mRNA 
0   NM_001031925.1  CG9130-RA, transcript variant A (CG9130), mRNA 
0   NM_001031921.1  CG9133-RD, transcript variant D (CG9133), mRNA 
0   NM_001031923.1  CG9133-RC, transcript variant C (CG9133), mRNA 
0   NM_132598.2  CG3989-RA (ade5), mRNA 
0   NM_133102.1  CG7274-RA (CG7274), mRNA 
0   NM_079282.1  CG3322-RA (LanB2), mRNA 
0   NM_140719.2  CG3885-RA (CG3885), mRNA 
0   NM_168508.1  CG32112-RC, transcript variant C (CG32112), mRNA 
0   NM_168507.1  CG32112-RB, transcript variant B (CG32112), mRNA 
0   NM_168506.1  CG32112-RA, transcript variant A (CG32112), mRNA 
0   NM_001032237.1  CG8529-RD, transcript variant D (Dyb), mRNA 
0   NM_078988.2  CG8529-RB, transcript variant B (Dyb), mRNA 
0   NM_165905.2  CG8529-RC, transcript variant C (Dyb), mRNA 
0   NM_165904.1  CG8529-RA, transcript variant A (Dyb), mRNA 
0   NM_001032236.1  CG8529-RE, transcript variant E (Dyb), mRNA 
0   NM_169021.1  CG1129-RB, transcript variant B (CG1129), mRNA 
0   NM_141241.2  CG1129-RA, transcript variant A (CG1129), mRNA 
0   NM_078787.2  CG13391-RA, transcript variant A (Aats-ala), mRNA 
0   NM_205934.1  CG13391-RB, transcript variant B (Aats-ala), mRNA 
0   NM_079040.3  CG4918-RA, transcript variant A (RpLP2), mRNA 
0   NM_206135.1  CG4918-RB, transcript variant B (RpLP2), mRNA 
0   10  NM_079572.2  CG9484-RA (hyd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.