National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10341R-4 
 Symbol CG10341  Full Name CG10341 
 CG No CG10341  Old CG No CG10341 
 Synonyms CG10341 
 Accession No (Link to NCBI) NM_136054.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J. Cell. Sci. (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCAGGTGGAAAATGAACTGG 
 Primer Seq. 3'
aatctagaggtaccCTTCTTCCGAAGTACGGTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCAGGTGGA AAATNAACTG GTAAATGAGT CAACACAAGC CATGACATCG ACCACAACCC 
0061 AGGAAAAGGT GGTGGGTTCA GTGAATAATC TTGTAGAGGA GCAACAGTGT GTGGAAATGG 
0121 AATTCGAAAC ATCATCAGAT CTCGTGGTCC AGGGAAGTCC ATCGGAAGAA TCCAAAAAAG 
0181 TTGCCTCTGA CGCTTCTGCT ACTGTGACCG CACCTCAAGT TCAGCCCGCT CCACATGTTG 
0241 ATTCAAGCCC TCAAGCAAGT GGCCTCAGTC TGTTGGCTGC CTACAGCTCT GATGACTCGG 
0301 ATGATGAGAA AGTCACTCCA GTGCAGAACG GCGACAACGA TGTGATTGAA GTTCCAGTTA 
0361 CGGACCCCGC ATCCTCCACC ACCGCATATC GTCCAGTTGT AGCTGTGAGC TCGGATGACG 
0421 AGAGCTCAAA GAGCAGCAGC AGCAGCAGTG ACTCAGACTC CGATTCCGAA GGAGAATACC 
0481 TCACCGTACT TCGGAAGAAG  
 in silico PCR Fragment
0001 AGCAGGTGGA AAATGAACTG GTAAATGAGT CAACACAAGC CATGACATCG ACCACAACCC 
0061 AGGAAAAGGT GGTGGGTTCA GTGAATAATC TTGTAGAGGA GCAACAGTGT GTGGAAATGG 
0121 AATTCGAAAC ATCATCAGAT CTCGTGGTCC AGGGAAGTCC ATCGGAAGAA TCCAAAAAAG 
0181 TTGCCTCTGA CGCTTCTGCT ACTGTGACCG CACCTCAAGT TCAGCCCGCT CCACATGTTG 
0241 ATTCAAGCCC TCAAGCAAGT GGCCTCAGTC TGTTGGCTGC CTACAGCTCT GATGACTCGG 
0301 ATGATGAGAA AGTCACTCCA GTGCAGAACG GCGACAACGA TGTGATTGAA GTTCCAGTTA 
0361 CGGACCCCGC ATCCTCCACC ACCGCATATC GTCCAGTTGT AGCTGTGAGC TCGGATGACG 
0421 AGAGCTCAAA GAGCAGCAGC AGCAGCAGTG ACTCAGACTC CGATTCCGAA GGAGAATACC 
0481 TCACCGTACT TCGGAAGAAG  
 Assemble Data

10341R-4.IR_full       1   AGCAGGTGGAAAATNAACTGGTAAATGAGTCAACACAAGCCATGACATCGACCACAACCC 60
                           |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     1   AGCAGGTGGAAAATGAACTGGTAAATGAGTCAACACAAGCCATGACATCGACCACAACCC 60


10341R-4.IR_full       61  AGGAAAAGGTGGTGGGTTCAGTGAATAATCTTGTAGAGGAGCAACAGTGTGTGGAAATGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     61  AGGAAAAGGTGGTGGGTTCAGTGAATAATCTTGTAGAGGAGCAACAGTGTGTGGAAATGG 120


10341R-4.IR_full       121 AATTCGAAACATCATCAGATCTCGTGGTCCAGGGAAGTCCATCGGAAGAATCCAAAAAAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     121 AATTCGAAACATCATCAGATCTCGTGGTCCAGGGAAGTCCATCGGAAGAATCCAAAAAAG 180


10341R-4.IR_full       181 TTGCCTCTGACGCTTCTGCTACTGTGACCGCACCTCAAGTTCAGCCCGCTCCACATGTTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     181 TTGCCTCTGACGCTTCTGCTACTGTGACCGCACCTCAAGTTCAGCCCGCTCCACATGTTG 240


10341R-4.IR_full       241 ATTCAAGCCCTCAAGCAAGTGGCCTCAGTCTGTTGGCTGCCTACAGCTCTGATGACTCGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     241 ATTCAAGCCCTCAAGCAAGTGGCCTCAGTCTGTTGGCTGCCTACAGCTCTGATGACTCGG 300


10341R-4.IR_full       301 ATGATGAGAAAGTCACTCCAGTGCAGAACGGCGACAACGATGTGATTGAAGTTCCAGTTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     301 ATGATGAGAAAGTCACTCCAGTGCAGAACGGCGACAACGATGTGATTGAAGTTCCAGTTA 360


10341R-4.IR_full       361 CGGACCCCGCATCCTCCACCACCGCATATCGTCCAGTTGTAGCTGTGAGCTCGGATGACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     361 CGGACCCCGCATCCTCCACCACCGCATATCGTCCAGTTGTAGCTGTGAGCTCGGATGACG 420


10341R-4.IR_full       421 AGAGCTCAAAGAGCAGCAGCAGCAGCAGTGACTCAGACTCCGATTCCGAAGGAGAATACC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10341R-4.in silico     421 AGAGCTCAAAGAGCAGCAGCAGCAGCAGTGACTCAGACTCCGATTCCGAAGGAGAATACC 480


10341R-4.IR_full       481 TCACCGTACTTCGGAAGAAG 500
                           ||||||||||||||||||||
10341R-4.in silico     481 TCACCGTACTTCGGAAGAAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136054.2  CG10341-RA (CG10341), mRNA 
0.62   NM_142356.2  CG4135-RA (beat-IIb), mRNA 
0.41   18  34  NM_168758.2  CG32193-RA (CG32193), mRNA 
0.41   12  NM_170186.1  CG31422-RA (CG31422), mRNA 
0.41   NM_058088.3  CG8730-RA (drosha), mRNA 
0.2   10  63  197  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0.2   40  96  NM_137212.2  CG30089-RA (CG30089), mRNA 
0.2   33  77  NM_168461.2  CG11711-RA, transcript variant A (Mob1), mRNA 
0.2   29  23  NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
0.2   29  23  NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
0.2   29  23  NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
0.2   12  NM_170239.2  CG31092-RA, transcript variant A (LpR2), mRNA 
0.2   13  25  NM_168460.1  CG11711-RD, transcript variant D (Mob1), mRNA 
0.2   13  25  NM_140217.1  CG11711-RC, transcript variant C (Mob1), mRNA 
0.2   13  25  NM_168462.1  CG11711-RB, transcript variant B (Mob1), mRNA 
0.2   20  NM_079416.2  CG4166-RA (not), mRNA 
0.2   NM_135632.1  CG16743-RA (CG16743), mRNA 
0.2   NM_136501.1  CG11191-RA (CG11191), mRNA 
0.2   18  NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0.2   18  NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0.2   14  NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0.2   NM_079812.2  CG5540-RA (Or98a), mRNA 
0   23  222  535  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   23  222  535  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   23  222  535  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   11  40  65  NM_057678.3  CG31240-RA (repo), mRNA 
0   10  57  148  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
0   10  53  122  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
0   71  248  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   71  248  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.