National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10338R-3 
 Symbol CG10338  Full Name CG10338 
 CG No CG10338  Old CG No CG10338 
 Synonyms CG10338 
 Accession No (Link to NCBI) NM_136053.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal, delta vein 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAGTACGGAAGAAAGGGGGA 
 Primer Seq. 3'
aatctagaggtaccTCGAGCAGCACAGGATTTGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAGTACGGA AGAAAGGGGG AGGAAATCCT CTATGTGACG CCAGCAGATC AGAGCAACAT 
0061 TGTGCGTGTG CCGCTGCGTG GGGATAAGCT GGTCATCCAG GAGAAGTTCC TGCTGTTTCG 
0121 CGTGCTGCAG AAGGTCTTCC TGCCCAAGGG CTATCCGGAT AGTGTCAGCG AGGACTATGC 
0181 AGCATACCAG ATCTGGGACA CGGCCCAGGC CTTCTGCAGC ACCATCTGCN GCACCCTGTG 
0241 CACACACGCC ATCTTGAAGG GCATCGGCGT GGGCAGCGAG AACATCAATG CCTTTTNCCG 
0301 CAACGGCGAC TTGGATCTTG AAGGAGGGCA GTGGTCACGT GGGTCGCATT GTGTTCGCAT 
0361 GGTGGCAGGG CTCCCAATTG GATGTGGACT CAAAGAAATG GCGCCTGCGT GCGGATTTTC 
0421 TGAACGATCT GGCCATGGGC ATCGAGATCT ACGTGCTTCC CAAGTATCCG CATTTCAGCA 
0481 CCCAAATCCT GTGCTGCTCG A 
 in silico PCR Fragment
0001 ACAGTACGGA AGAAAGGGGG AGGAAATCCT CTATGTGACG CCAGCAGATC AGAGCAACAT 
0061 TGTGCGTGTG CCGCTGCGTG GGGATAAGCT GGTCATCCAG GAGAAGTTCC TGCTGTTTCG 
0121 CGTGCTGCAG AAGGTCTTCC TGCCCAAGGG CTATCCGGAT AGTGTCAGCG AGGACTATGC 
0181 AGCATACCAG ATCTGGGACA CGGCCCAGGC CTTCTGCAGC ACCATCTGCG GCACCCTGTG 
0241 CACACACGCC ATCTTGAAGG GCATCGGCGT GGGCAGCGAG AACATCAATG CCTTTT-CCG 
0301 CAACGGCGAC TTGGATCTTG AAGGAGGGCA GTGGTCACGT GGGTCGCATT GTGTTCGCAT 
0361 GGTGGCAGGG CTCCCAATTG GATGTGGACT CAAAGAAATG GCGCCTGCGT GCGGATTTTC 
0421 TGAACGATCT GGCCATGGGC ATCGAGATCT ACGTGCTTCC CAAGTATCCG CATTTCAGCA 
0481 CCCAAATCCT GTGCTGCTCG A 
 Assemble Data

10338R-3.IR_full       1   ACAGTACGGAAGAAAGGGGGAGGAAATCCTCTATGTGACGCCAGCAGATCAGAGCAACAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10338R-3.in silico     1   ACAGTACGGAAGAAAGGGGGAGGAAATCCTCTATGTGACGCCAGCAGATCAGAGCAACAT 60


10338R-3.IR_full       61  TGTGCGTGTGCCGCTGCGTGGGGATAAGCTGGTCATCCAGGAGAAGTTCCTGCTGTTTCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10338R-3.in silico     61  TGTGCGTGTGCCGCTGCGTGGGGATAAGCTGGTCATCCAGGAGAAGTTCCTGCTGTTTCG 120


10338R-3.IR_full       121 CGTGCTGCAGAAGGTCTTCCTGCCCAAGGGCTATCCGGATAGTGTCAGCGAGGACTATGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10338R-3.in silico     121 CGTGCTGCAGAAGGTCTTCCTGCCCAAGGGCTATCCGGATAGTGTCAGCGAGGACTATGC 180


10338R-3.IR_full       181 AGCATACCAGATCTGGGACACGGCCCAGGCCTTCTGCAGCACCATCTGCNGCACCCTGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
10338R-3.in silico     181 AGCATACCAGATCTGGGACACGGCCCAGGCCTTCTGCAGCACCATCTGCGGCACCCTGTG 240


10338R-3.IR_full       241 CACACACGCCATCTTGAAGGGCATCGGCGTGGGCAGCGAGAACATCAATGCCTTTTNCCG 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
10338R-3.in silico     241 CACACACGCCATCTTGAAGGGCATCGGCGTGGGCAGCGAGAACATCAATGCCTTTT-CCG 300


10338R-3.IR_full       301 CAACGGCGACTTGGATCTTGAAGGAGGGCAGTGGTCACGTGGGTCGCATTGTGTTCGCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10338R-3.in silico     301 CAACGGCGACTTGGATCTTGAAGGAGGGCAGTGGTCACGTGGGTCGCATTGTGTTCGCAT 360


10338R-3.IR_full       361 GGTGGCAGGGCTCCCAATTGGATGTGGACTCAAAGAAATGGCGCCTGCGTGCGGATTTTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10338R-3.in silico     361 GGTGGCAGGGCTCCCAATTGGATGTGGACTCAAAGAAATGGCGCCTGCGTGCGGATTTTC 420


10338R-3.IR_full       421 TGAACGATCTGGCCATGGGCATCGAGATCTACGTGCTTCCCAAGTATCCGCATTTCAGCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10338R-3.in silico     421 TGAACGATCTGGCCATGGGCATCGAGATCTACGTGCTTCCCAAGTATCCGCATTTCAGCA 480


10338R-3.IR_full       481 CCCAAATCCTGTGCTGCTCGA 501
                           |||||||||||||||||||||
10338R-3.in silico     481 CCCAAATCCTGTGCTGCTCGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136053.2  CG10338-RA (CG10338), mRNA 
0   NM_169484.1  CG7241-RA (Cyp304a1), mRNA 
0   NM_078696.2  CG1467-RA (Syx16), mRNA 
0   10  NM_140424.1  CG9007-RA (CG9007), mRNA 
0   NM_134529.2  CG9575-RA (Rab35), mRNA 
0   NM_169414.1  CG17309-RB, transcript variant B (Csk), mRNA 
0   NM_001014509.1  CG8732-RG, transcript variant G (l(2)44DEa), mRNA 
0   NM_001014508.1  CG8732-RH, transcript variant H (l(2)44DEa), mRNA 
0   NM_170616.1  CG8732-RC, transcript variant C (l(2)44DEa), mRNA 
0   NM_001014507.1  CG8732-RI, transcript variant I (l(2)44DEa), mRNA 
0   NM_001014510.1  CG8732-RF, transcript variant F (l(2)44DEa), mRNA 
0   NM_001014512.1  CG8732-RD, transcript variant D (l(2)44DEa), mRNA 
0   NM_143777.2  CG8732-RB, transcript variant B (l(2)44DEa), mRNA 
0   NM_170615.1  CG8732-RA, transcript variant A (l(2)44DEa), mRNA 
0   NM_001014511.1  CG8732-RE, transcript variant E (l(2)44DEa), mRNA 
0   NM_143613.2  CG12063-RA (CG12063), mRNA 
0   NM_079274.2  CG4167-RA (Hsp67Ba), mRNA 
0   NM_140373.1  CG14116-RA (CG14116), mRNA 
0   NM_001014630.1  CG33547-RA (Rim), mRNA 
0   NM_132034.1  CG3108-RA (CG3108), mRNA 
0   NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
0   NM_139519.2  CG14962-RA (CG14962), mRNA 
0   NM_142226.1  CG4520-RA (CG4520), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_001042807.1  CG34143-RB, transcript variant B (CG34143), mRNA 
0   NM_134536.2  CG17065-RA (CG17065), mRNA 
0   NM_165045.1  CG31847-RA (CG31847), mRNA 
0   NM_135887.2  CG3491-RA (CG3491), mRNA 
0   NM_079226.2  CG18647-RA (bin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.