National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10336R-4 
 Symbol CG10336  Full Name CG10336 
 CG No CG10336  Old CG No CG10336 
 Synonyms CG10336 
 Accession No (Link to NCBI) NM_165261.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGCATCCCTGTTCGGAGATGATGGTGTGGATGACCTATTCAATGACAACATTCCGACT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACCCGGATCAGCTGCCCAGCGATGGCGAAGGCGAAAAGCTGTTTGCGGACGACGAGGAC 120

                           |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AACGGCGTAGAA-CCTGGTAGCCAGGATGCCCAGATAGTGGAGCCTAAGAAGCGAGCTGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGAAATCCCCGACCGCGACTCACTGTGGAAACACTTCGAGGTCCTCGTGGCATCCAGAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATCGAAGATTATTTTAAGGACATCAAATTCAAGGGCAAGGGTTACGAGAAAACCGATCT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGACGAGGTGCTTCGCCGCCTGCAGCACTGGGGCCATCGTATGTATCCCACCTACACCTT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGACGATGTGCTTAACAATATCGAACGGCTGGGCAAGAAGAAACCCCTCCAAGTGCACAT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCGCGATATCGACTCGGTCAGCTGGAGCAGATGCGCGCCCACGAAGCGGAGGCCCTGGA 480

10336R-4.IR_full       481 GGAGGCGCAGGATGAGCAACA 501
                           ||||||||||||||||||||| silico     481 GGAGGCGCAGGATGAGCAACA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136051.1  CG10336-RB, transcript variant B (CG10336), mRNA 
100   482  NM_165261.1  CG10336-RA, transcript variant A (CG10336), mRNA 
0   NM_140591.2  CG13072-RA (PDCD-5), mRNA 
0   NM_206069.1  CG12919-RB, transcript variant B (egr), mRNA 
0   NM_165735.2  CG12919-RA, transcript variant A (egr), mRNA 
0   NM_132797.2  CG9198-RA, transcript variant A (shtd), mRNA 
0   NM_175991.1  CG10595-RA, transcript variant A (d), mRNA 
0   NM_205939.1  CG10595-RC, transcript variant C (d), mRNA 
0   NM_205940.1  CG10595-RB, transcript variant B (d), mRNA 
0   NM_079193.2  CG1167-RA (Ras64B), mRNA 
0   NM_130677.1  CG14418-RA (CG14418), mRNA 
0   NM_142486.2  CG7708-RA, transcript variant A (CG7708), mRNA 
0   NM_169832.1  CG7708-RB, transcript variant B (CG7708), mRNA 
0   12  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_137518.2  CG15073-RA (CG15073), mRNA 
0   NM_136223.2  CG9335-RA (CG9335), mRNA 
0   NM_142874.2  CG6747-RA (Ir), mRNA 
0   NM_175995.1  CG32983-RA (CG32983), mRNA 
0   NM_078700.2  CG1849-RA (run), mRNA 
0   NM_136397.1  CG15236-RA, transcript variant A (CG15236), mRNA 
0   NM_165493.1  CG15236-RB, transcript variant B (CG15236), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_142371.1  CG14330-RA (CG14330), mRNA 
0   NM_138090.1  CG12252-RA (CG12252), mRNA 
0   NM_137246.1  CG10734-RA (CG10734), mRNA 
0   NM_136634.2  CG1975-RA (Rep2), mRNA 
0   NM_132850.2  CG8995-RA (PGRP-LE), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.